Transcript: Human XM_011545671.3

PREDICTED: Homo sapiens SPATA31 subfamily A member 5 (SPATA31A5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATA31A5 (727905)
Length:
4291
CDS:
23..4144

Additional Resources:

NCBI RefSeq record:
XM_011545671.3
NBCI Gene record:
SPATA31A5 (727905)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545671.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269496 CCCGAGTGCCAACCCTTTATT pLKO_005 1529 CDS 100% 15.000 7.500 Y SPATA31A1 n/a
2 TRCN0000269660 CCGAGTGCCAACCCTTTATTT pLKO_005 1530 CDS 100% 15.000 7.500 Y SPATA31A3 n/a
3 TRCN0000352439 GACTCGGGAAGTGATTTATTA pLKO_005 2234 CDS 100% 15.000 7.500 Y SPATA31A6 n/a
4 TRCN0000269662 GTGACTCGGGAAGTGATTTAT pLKO_005 2232 CDS 100% 15.000 7.500 Y SPATA31A3 n/a
5 TRCN0000371108 ATGCACAGAGAGGACTCATAT pLKO_005 2257 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
6 TRCN0000371109 CAAGCCCATTCAGTGCTTTAA pLKO_005 2560 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
7 TRCN0000352398 CAGAACCTCGTGCGCCTTTAA pLKO_005 961 CDS 100% 13.200 6.600 Y SPATA31A6 n/a
8 TRCN0000269765 CATGACGGCAGTTGGACAAAT pLKO_005 3727 CDS 100% 13.200 6.600 Y SPATA31A5 n/a
9 TRCN0000269764 CGCCATGCCTCGAAGGTAAAT pLKO_005 3779 CDS 100% 13.200 6.600 Y SPATA31A5 n/a
10 TRCN0000269421 CTTGCCCTGCATCGCAGAATA pLKO_005 1671 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
11 TRCN0000371051 GAGTGACTCGGGAAGTGATTT pLKO_005 2230 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
12 TRCN0000284087 GCACAGAGAGGACTCATATAG pLKO_005 2259 CDS 100% 13.200 6.600 Y SPATA31A5 n/a
13 TRCN0000352417 GGGTAACTGACAGGTCTTATA pLKO_005 1395 CDS 100% 13.200 6.600 Y SPATA31A6 n/a
14 TRCN0000269663 GGTAACTGACAGGTCTTATAC pLKO_005 1396 CDS 100% 13.200 6.600 Y SPATA31A3 n/a
15 TRCN0000269420 TCTTATGGAGGAGGTTGTTAA pLKO_005 3112 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
16 TRCN0000269495 TGCACAGAGAGGACTCATATA pLKO_005 2258 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
17 TRCN0000344441 TGCGGGACTCCACACTGATAA pLKO_005 786 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
18 TRCN0000269443 TGGGTAACTGACAGGTCTTAT pLKO_005 1394 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
19 TRCN0000284090 TTTGCGGAATTTGGCTAAATC pLKO_005 1186 CDS 100% 13.200 6.600 Y SPATA31A5 n/a
20 TRCN0000269475 ACTTAGTGCCTCATCGCTAAA pLKO_005 94 CDS 100% 10.800 5.400 Y SPATA31A1 n/a
21 TRCN0000284091 AGTCTAGGAAACCCAACTTAG pLKO_005 3435 CDS 100% 10.800 5.400 Y SPATA31A5 n/a
22 TRCN0000269505 CTTAGTGCCTCATCGCTAAAC pLKO_005 95 CDS 100% 10.800 5.400 Y SPATA31A1 n/a
23 TRCN0000144768 CAGGAAAGTTTGACATCCATT pLKO.1 1832 CDS 100% 4.950 2.475 Y SPATA31A7 n/a
24 TRCN0000142540 GCCCAATTCAAAGGGAGACTA pLKO.1 1461 CDS 100% 4.950 2.475 Y SPATA31A7 n/a
25 TRCN0000141870 GCTTGTCTCCACATGAGGATT pLKO.1 858 CDS 100% 4.950 2.475 Y SPATA31A7 n/a
26 TRCN0000143757 CCAGGAAAGTTTGACATCCAT pLKO.1 1831 CDS 100% 3.000 1.500 Y SPATA31A7 n/a
27 TRCN0000142675 CACATGAGGATTTGGTGGCTT pLKO.1 867 CDS 100% 2.640 1.320 Y SPATA31A7 n/a
28 TRCN0000143834 CACCTTGACAAAGGTGACTTT pLKO.1 422 CDS 100% 0.495 0.248 Y SPATA31A7 n/a
29 TRCN0000269711 TCTTATGGAGGAGGTTGTTAG pLKO_005 3112 CDS 100% 10.800 5.400 Y SPATA31A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545671.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.