Transcript: Human XM_011545913.2

PREDICTED: Homo sapiens sodium channel epithelial 1 beta subunit (SCNN1B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCNN1B (6338)
Length:
2585
CDS:
136..2091

Additional Resources:

NCBI RefSeq record:
XM_011545913.2
NBCI Gene record:
SCNN1B (6338)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437903 CTTCACGAGCAGAGGTCATAC pLKO_005 1126 CDS 100% 10.800 15.120 N SCNN1B n/a
2 TRCN0000415238 CAAGACCACATGATCCGTAAC pLKO_005 1342 CDS 100% 6.000 8.400 N SCNN1B n/a
3 TRCN0000043930 GAATTTAACTATCGCACCATT pLKO.1 1669 CDS 100% 4.950 6.930 N SCNN1B n/a
4 TRCN0000043929 CGACTTTGTGTGGATCACCAT pLKO.1 1803 CDS 100% 2.640 3.696 N SCNN1B n/a
5 TRCN0000437321 GCGGGACCAAAGCACCAATAT pLKO_005 1602 CDS 100% 13.200 10.560 N SCNN1B n/a
6 TRCN0000043931 CCCATGGTCCTTGATCTCTTT pLKO.1 649 CDS 100% 4.950 3.465 N SCNN1B n/a
7 TRCN0000043932 CATGAGACTATGTAGCCTCAA pLKO.1 744 CDS 100% 4.050 2.835 N SCNN1B n/a
8 TRCN0000043928 CCTGAAGTTGATCCTGGACAT pLKO.1 1050 CDS 100% 4.050 2.835 N SCNN1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06915 pDONR223 100% 98.2% 98.1% None 1_33del;155T>C n/a
2 ccsbBroad304_06915 pLX_304 0% 98.2% 98.1% V5 1_33del;155T>C n/a
3 TRCN0000473454 GAACTTTGTCAAGCAAGGTATCGC pLX_317 24.3% 98.2% 98.1% V5 1_33del;155T>C n/a
Download CSV