Transcript: Human XM_011546205.1

PREDICTED: Homo sapiens olfactory receptor 4N4-like (LOC102723532), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC102723532 (102723532)
Length:
2277
CDS:
1055..2251

Additional Resources:

NCBI RefSeq record:
XM_011546205.1
NBCI Gene record:
LOC102723532 (102723532)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011546205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186382 CTTCTCTGAGAAGAAGGTAAT pLKO.1 1555 CDS 100% 1.080 0.648 N OR4N4 n/a
2 TRCN0000187852 GCACCACTCGTGTCATTATTA pLKO.1 2019 CDS 100% 15.000 7.500 Y OR4N4 n/a
3 TRCN0000185740 GTCTTTGTGCTGATCTTAATT pLKO.1 1379 CDS 100% 15.000 7.500 Y OR4N4 n/a
4 TRCN0000187495 GATGCATCCTACTCCTTCATT pLKO.1 1508 CDS 100% 5.625 2.813 Y OR4N4 n/a
5 TRCN0000188464 CTGATGACACTCCTGTGCTTT pLKO.1 1913 CDS 100% 4.950 2.475 Y OR4N4 n/a
6 TRCN0000204121 GCACTGTTCAACTGTCATGAA pLKO.1 1690 CDS 100% 4.950 2.475 Y OR4N4 n/a
7 TRCN0000188833 GCTCTTGGTCTTTGTGCTGAT pLKO.1 1372 CDS 100% 4.050 2.025 Y OR4N4 n/a
8 TRCN0000186868 GTCTCAAGATATTCAGCTCTT pLKO.1 1357 CDS 100% 4.050 2.025 Y OR4N4 n/a
9 TRCN0000187422 CCTCTATTTCTTTCTGGGCAA pLKO.1 1474 CDS 100% 2.160 1.080 Y OR4N2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011546205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09947 pDONR223 100% 78.9% 78.6% None (many diffs) n/a
2 ccsbBroad304_09947 pLX_304 0% 78.9% 78.6% V5 (many diffs) n/a
3 TRCN0000475845 ACATCCATTCGCTTTCGACAGAAA pLX_317 30.3% 78.9% 78.6% V5 (many diffs) n/a
Download CSV