Transcript: Human XM_017000005.1

PREDICTED: Homo sapiens glycoprotein A33 (GPA33), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPA33 (10223)
Length:
2630
CDS:
497..1132

Additional Resources:

NCBI RefSeq record:
XM_017000005.1
NBCI Gene record:
GPA33 (10223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060688 CGCGTCAGCATATCCAACAAT pLKO.1 434 5UTR 100% 5.625 7.875 N GPA33 n/a
2 TRCN0000060692 AGAGACCATAATTGGGAACAA pLKO.1 622 CDS 100% 4.950 6.930 N GPA33 n/a
3 TRCN0000060689 AGGGACTTATTCAATGGGATA pLKO.1 330 5UTR 100% 4.050 3.240 N GPA33 n/a
4 TRCN0000430016 ACATCCATGGTGAGCTTTATA pLKO_005 408 5UTR 100% 15.000 10.500 N GPA33 n/a
5 TRCN0000416962 AGAGGTACAACATCCTGAATC pLKO_005 699 CDS 100% 10.800 7.560 N GPA33 n/a
6 TRCN0000412396 ATGAAAGAATAAGTGAGTATG pLKO_005 1594 3UTR 100% 10.800 7.560 N GPA33 n/a
7 TRCN0000060691 CACAGACACATCGGGTTACTA pLKO.1 778 CDS 100% 5.625 3.938 N GPA33 n/a
8 TRCN0000426014 ATACGGAAAGGGTGGTCATCT pLKO_005 366 5UTR 100% 4.950 3.465 N GPA33 n/a
9 TRCN0000060690 GAGGATGACTACAGGCAAGAA pLKO.1 1064 CDS 100% 4.950 3.465 N GPA33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02360 pDONR223 100% 66.1% 66.1% None 0_1ins324 n/a
2 ccsbBroad304_02360 pLX_304 0% 66.1% 66.1% V5 0_1ins324 n/a
3 TRCN0000472677 TGGCCTCGTATAACACATTGGCAC pLX_317 38.4% 66.1% 66.1% V5 0_1ins324 n/a
Download CSV