Transcript: Human XM_017000079.1

PREDICTED: Homo sapiens semaphorin 6C (SEMA6C), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEMA6C (10500)
Length:
5234
CDS:
1670..4462

Additional Resources:

NCBI RefSeq record:
XM_017000079.1
NBCI Gene record:
SEMA6C (10500)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005663 CCGAGTATGTAAACGTGACAT pLKO.1 2446 CDS 100% 4.950 6.930 N SEMA6C n/a
2 TRCN0000413116 AGTCCAACGTGGCCATCTTTG pLKO_005 2193 CDS 100% 10.800 8.640 N SEMA6C n/a
3 TRCN0000005664 GCTGTAGTTTACAGAAGCCTT pLKO.1 2264 CDS 100% 2.640 2.112 N SEMA6C n/a
4 TRCN0000418932 ATGAGTGCTACAACTATATTC pLKO_005 2025 CDS 100% 13.200 9.240 N SEMA6C n/a
5 TRCN0000423159 CTTCACCACCCAGACCAATAG pLKO_005 2623 CDS 100% 10.800 7.560 N SEMA6C n/a
6 TRCN0000412722 TCCTCAGTGAGCCAGCATTTC pLKO_005 4675 3UTR 100% 10.800 7.560 N SEMA6C n/a
7 TRCN0000005662 CGCCTCGGGTTTATTTATTGA pLKO.1 4604 3UTR 100% 5.625 3.938 N SEMA6C n/a
8 TRCN0000005666 GTGGAACCAGAACAGGAACAA pLKO.1 3829 CDS 100% 4.950 3.465 N SEMA6C n/a
9 TRCN0000005665 GATGTGGAGAACTGTGCTGTA pLKO.1 1988 CDS 100% 4.050 2.835 N SEMA6C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11508 pDONR223 100% 51.9% 46% None (many diffs) n/a
2 ccsbBroad304_11508 pLX_304 0% 51.9% 46% V5 (many diffs) n/a
3 TRCN0000468488 TGAGGCTCTTGCAGCGGACGCTCC pLX_317 27.4% 51.9% 46% V5 (many diffs) n/a
4 ccsbBroadEn_11509 pDONR223 100% 46.7% 44% None (many diffs) n/a
5 ccsbBroad304_11509 pLX_304 0% 46.7% 44% V5 (many diffs) n/a
6 TRCN0000481611 ACGCTCACTTGGTATTACATGAGA pLX_317 27.6% 46.7% 44% V5 (many diffs) n/a
Download CSV