Transcript: Human XM_017000118.1

PREDICTED: Homo sapiens urotensin 2 (UTS2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UTS2 (10911)
Length:
765
CDS:
97..429

Additional Resources:

NCBI RefSeq record:
XM_017000118.1
NBCI Gene record:
UTS2 (10911)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000118.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152857 GAAAGCAGACTCAAGTACCAA pLKO.1 213 CDS 100% 3.000 4.200 N UTS2 n/a
2 TRCN0000151896 CAGAATCTGGAAACCATACAA pLKO.1 318 CDS 100% 5.625 3.938 N UTS2 n/a
3 TRCN0000152050 CCCAAGAGGAAATTTGAGAAA pLKO.1 243 CDS 100% 4.950 3.465 N UTS2 n/a
4 TRCN0000150862 GAATCTGGAAACCATACAAGA pLKO.1 320 CDS 100% 4.950 3.465 N UTS2 n/a
5 TRCN0000155693 CTCAGGAAAGCAGACTCAAGT pLKO.1 208 CDS 100% 4.950 2.970 N UTS2 n/a
6 TRCN0000154739 GAGCTAGAAAGAGCTTCCCTT pLKO.1 142 CDS 100% 2.640 1.584 N UTS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000118.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11569 pDONR223 100% 82.4% 77.2% None (many diffs) n/a
2 ccsbBroad304_11569 pLX_304 0% 82.4% 77.2% V5 (many diffs) n/a
3 TRCN0000476078 TCGCCGATCGCCCCGATAGCCCCC pLX_317 100% 82.4% 77.2% V5 (many diffs) n/a
Download CSV