Transcript: Human XM_017000369.1

PREDICTED: Homo sapiens colony stimulating factor 1 (CSF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CSF1 (1435)
Length:
3907
CDS:
212..1753

Additional Resources:

NCBI RefSeq record:
XM_017000369.1
NBCI Gene record:
CSF1 (1435)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000369.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282422 TCTCCTGGTACAAGACATAAT pLKO_005 346 CDS 100% 13.200 18.480 N CSF1 n/a
2 TRCN0000262773 AGATCCAGTGTGCTACCTTAA pLKO_005 316 CDS 100% 10.800 15.120 N CSF1 n/a
3 TRCN0000262774 GTCGGCCTGATTTCCCGTAAA pLKO_005 2264 3UTR 100% 10.800 15.120 N CSF1 n/a
4 TRCN0000262776 TTGACAAGGACTGGAATATTT pLKO_005 567 CDS 100% 15.000 10.500 N CSF1 n/a
5 TRCN0000262775 AGTACTGTAGCCACATGATTG pLKO_005 198 5UTR 100% 10.800 7.560 N CSF1 n/a
6 TRCN0000058559 CGTGCCAAATTACATTTGAGT pLKO.1 273 CDS 100% 3.000 2.100 N CSF1 n/a
7 TRCN0000058561 GCGTCCGAACTTTCTATGAGA pLKO.1 489 CDS 100% 3.000 2.100 N CSF1 n/a
8 TRCN0000058560 AGGATATTCTTGACTCTGCAA pLKO.1 963 CDS 100% 2.640 1.848 N CSF1 n/a
9 TRCN0000058562 CCTTTGACTGACACAGGCCAT pLKO.1 1511 CDS 100% 2.160 1.512 N CSF1 n/a
10 TRCN0000058558 CCACTATTTATTGTGAGCCCT pLKO.1 1977 3UTR 100% 0.660 0.462 N CSF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000369.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06049 pDONR223 100% 92.4% 92.4% None (many diffs) n/a
2 ccsbBroad304_06049 pLX_304 0% 92.4% 92.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000467653 TACACTGTCTTATATTTCATTCTT pLX_317 24.4% 92.4% 92.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV