Transcript: Human XM_017000488.1

PREDICTED: Homo sapiens consortin, connexin sorting protein (CNST), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNST (163882)
Length:
5021
CDS:
684..2339

Additional Resources:

NCBI RefSeq record:
XM_017000488.1
NBCI Gene record:
CNST (163882)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134667 GCATTGATTTCTGAGGGTAAA pLKO.1 1494 CDS 100% 10.800 15.120 N CNST n/a
2 TRCN0000136781 CCACATACAGTTACGGCTCTA pLKO.1 888 CDS 100% 4.050 5.670 N CNST n/a
3 TRCN0000133884 CCAAGAAATAGACGATAGCTT pLKO.1 2105 CDS 100% 3.000 2.400 N CNST n/a
4 TRCN0000134732 GCAAACGCTTACACCTATTAT pLKO.1 3193 3UTR 100% 15.000 10.500 N CNST n/a
5 TRCN0000134886 CCTTATGGTTTCAGTGTCATT pLKO.1 2770 3UTR 100% 4.950 3.465 N CNST n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09755 pDONR223 100% 60.8% 58.3% None (many diffs) n/a
2 ccsbBroad304_09755 pLX_304 0% 60.8% 58.3% V5 (many diffs) n/a
3 TRCN0000466018 CTTTGGTCGGCTCTAATGATCAGA pLX_317 19.8% 60.8% 58.3% V5 (many diffs) n/a
Download CSV