Transcript: Human XM_017000524.2

PREDICTED: Homo sapiens argonaute RISC catalytic component 3 (AGO3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGO3 (192669)
Length:
2921
CDS:
316..2196

Additional Resources:

NCBI RefSeq record:
XM_017000524.2
NBCI Gene record:
AGO3 (192669)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421882 AGACATCACACTCGATTATTT pLKO_005 1744 CDS 100% 15.000 21.000 N AGO3 n/a
2 TRCN0000416716 AGAGAACAGTAGCGCAGTATT pLKO_005 530 CDS 100% 13.200 18.480 N AGO3 n/a
3 TRCN0000425075 CGCTTAAATAGTCCAAGTATA pLKO_005 2190 CDS 100% 13.200 18.480 N AGO3 n/a
4 TRCN0000007869 CGGGAACTTCTTATTCAATTT pLKO.1 1555 CDS 100% 13.200 18.480 N AGO3 n/a
5 TRCN0000007870 CCAAGATACCTTACGCACAAT pLKO.1 2163 CDS 100% 4.950 6.930 N AGO3 n/a
6 TRCN0000009637 CCTGCCACTAGAAGTCTGTAA pLKO.1 630 CDS 100% 4.950 6.930 N Ago3 n/a
7 TRCN0000011204 CGGGATGAAATGGCTCATGTA pLKO.1 820 CDS 100% 4.950 6.930 N AGO3 n/a
8 TRCN0000429285 GACTGATTCTCATCGGGTAAA pLKO_005 366 CDS 100% 10.800 8.640 N Ago3 n/a
9 TRCN0000416338 GCAGTTTAGGCAGGTATTATA pLKO_005 1638 CDS 100% 15.000 10.500 N AGO3 n/a
10 TRCN0000007868 GCGGTCTCCTATAGGAAGTAT pLKO.1 2419 3UTR 100% 5.625 3.938 N AGO3 n/a
11 TRCN0000007871 CCTACAGCTTATTATCGTCAT pLKO.1 1158 CDS 100% 4.050 2.835 N AGO3 n/a
12 TRCN0000009636 CCTGGAATAACCTACATTGTT pLKO.1 1714 CDS 100% 5.625 3.938 N Ago3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11852 pDONR223 100% 44.9% 54.6% None (many diffs) n/a
2 ccsbBroad304_11852 pLX_304 0% 44.9% 54.6% V5 (many diffs) n/a
Download CSV