Transcript: Human XM_017000566.1

PREDICTED: Homo sapiens Tctex1 domain containing 1 (TCTEX1D1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCTEX1D1 (200132)
Length:
2564
CDS:
428..967

Additional Resources:

NCBI RefSeq record:
XM_017000566.1
NBCI Gene record:
TCTEX1D1 (200132)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000566.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121920 CTTGATGATTCCACGGTATAA pLKO.1 787 CDS 100% 13.200 18.480 N TCTEX1D1 n/a
2 TRCN0000143616 GAAATTCATGGGCGCATCAAA pLKO.1 524 CDS 100% 5.625 7.875 N TCTEX1D1 n/a
3 TRCN0000145263 GATGTAGTAACCAGCTATCTA pLKO.1 686 CDS 100% 5.625 4.500 N TCTEX1D1 n/a
4 TRCN0000143225 GCAGGAACTTGATCTTGGTTT pLKO.1 1169 3UTR 100% 4.950 3.960 N TCTEX1D1 n/a
5 TRCN0000121813 GTAACCAGCTATCTACAAGTA pLKO.1 692 CDS 100% 4.950 3.960 N TCTEX1D1 n/a
6 TRCN0000121921 CCACAGAAAGAATCTTGTTTA pLKO.1 1142 3UTR 100% 13.200 9.240 N TCTEX1D1 n/a
7 TRCN0000143892 CAGGTCAAGGACTTGATGATT pLKO.1 776 CDS 100% 5.625 3.938 N TCTEX1D1 n/a
8 TRCN0000143615 GCAGCTCATTCATGGAAGAAA pLKO.1 458 CDS 100% 5.625 3.938 N TCTEX1D1 n/a
9 TRCN0000145187 GCCACAGAAAGAATCTTGTTT pLKO.1 1141 3UTR 100% 5.625 3.938 N TCTEX1D1 n/a
10 TRCN0000121814 GCTATCTACAAGTAGAAGAAT pLKO.1 699 CDS 100% 5.625 3.938 N TCTEX1D1 n/a
11 TRCN0000141290 CAACTGAACAGGCAGAGCATA pLKO.1 833 CDS 100% 4.950 3.465 N TCTEX1D1 n/a
12 TRCN0000144744 GCAGCATTCATTAAGTGCAAT pLKO.1 1450 3UTR 100% 4.950 3.465 N TCTEX1D1 n/a
13 TRCN0000143327 GCCTTACAGTTCAGATGGAAA pLKO.1 603 CDS 100% 4.950 3.465 N TCTEX1D1 n/a
14 TRCN0000141603 CGTGATGATATCTCTCGCCTT pLKO.1 587 CDS 100% 2.160 1.512 N TCTEX1D1 n/a
15 TRCN0000183082 CAAATGTCTATGCAGTTTACT pLKO.1 939 CDS 100% 5.625 3.938 N Tctex1d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000566.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09803 pDONR223 100% 99.8% 99.4% None 427C>A n/a
2 ccsbBroad304_09803 pLX_304 0% 99.8% 99.4% V5 427C>A n/a
3 TRCN0000474023 CTTAACCACATTTTTCTTTAGAGA pLX_317 98.9% 99.8% 99.4% V5 427C>A n/a
Download CSV