Transcript: Human XM_017000869.2

PREDICTED: Homo sapiens solute carrier family 35 member A3 (SLC35A3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC35A3 (23443)
Length:
7051
CDS:
1781..2635

Additional Resources:

NCBI RefSeq record:
XM_017000869.2
NBCI Gene record:
SLC35A3 (23443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000869.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434277 GCAACCTCTTTATCGATAATA pLKO_005 2474 CDS 100% 15.000 21.000 N SLC35A3 n/a
2 TRCN0000043442 GCGTTATTCCAGAACTTTAAA pLKO.1 1852 CDS 100% 15.000 21.000 N SLC35A3 n/a
3 TRCN0000432082 AGAAGGACCTCGTTATCTATC pLKO_005 1876 CDS 100% 10.800 15.120 N SLC35A3 n/a
4 TRCN0000043440 CCTCAGATTCTCAGCTTGATT pLKO.1 2127 CDS 100% 5.625 3.938 N SLC35A3 n/a
5 TRCN0000043438 GCTGTTATTAAGTATGCAGAT pLKO.1 2435 CDS 100% 4.050 2.835 N SLC35A3 n/a
6 TRCN0000433417 ACTCTTTCTGTACAGATATAT pLKO_005 3010 3UTR 100% 15.000 9.000 N SLC35A3 n/a
7 TRCN0000043439 CCATCCTTGTAATAACAGCTA pLKO.1 2562 CDS 100% 2.640 1.584 N SLC35A3 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4450 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4729 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000157407 GATCTCGGCTTACTGCAACTT pLKO.1 4841 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000869.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11735 pDONR223 100% 52.8% 52.6% None (many diffs) n/a
2 ccsbBroad304_11735 pLX_304 0% 52.8% 52.6% V5 (many diffs) n/a
3 TRCN0000469720 GAAGGATTTCGGTCTGCAATATCG pLX_317 61.9% 52.8% 52.6% V5 (many diffs) n/a
Download CSV