Transcript: Human XM_017000989.1

PREDICTED: Homo sapiens dynamin 3 (DNM3), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNM3 (26052)
Length:
2982
CDS:
163..1869

Additional Resources:

NCBI RefSeq record:
XM_017000989.1
NBCI Gene record:
DNM3 (26052)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051406 CGAGGGAGAACTGTCTGATTT pLKO.1 656 CDS 100% 13.200 10.560 N DNM3 n/a
2 TRCN0000379467 ATTTCCTCCATACCCATTAAT pLKO_005 505 CDS 100% 15.000 10.500 N DNM3 n/a
3 TRCN0000379523 GTGTTAAATCTAACCCTTATT pLKO_005 547 CDS 100% 13.200 9.240 N DNM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11804 pDONR223 100% 97.5% 97.3% None (many diffs) n/a
2 ccsbBroad304_11804 pLX_304 0% 97.5% 97.3% V5 (many diffs) n/a
3 TRCN0000468730 GATCTCCAGAATTACCCCTGCCCC pLX_317 23.8% 97.5% 97.3% V5 (many diffs) n/a
Download CSV