Transcript: Human XM_017001058.1

PREDICTED: Homo sapiens amylase alpha 1C (AMY1C), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AMY1C (278)
Length:
1702
CDS:
133..1668

Additional Resources:

NCBI RefSeq record:
XM_017001058.1
NBCI Gene record:
AMY1C (278)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001058.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371249 ACCAACCAGTTAGCTATAAAT pLKO_005 362 CDS 100% 15.000 7.500 Y AMY1A n/a
2 TRCN0000056061 CCAACCAGTTAGCTATAAATT pLKO.1 363 CDS 100% 15.000 7.500 Y AMY2B n/a
3 TRCN0000254839 CTTGAATGTGAGCGATATTTA pLKO_005 253 CDS 100% 15.000 7.500 Y AMY1B n/a
4 TRCN0000254838 GTTCTAAGATTGCCGAATATA pLKO_005 704 CDS 100% 15.000 7.500 Y AMY1B n/a
5 TRCN0000371251 CTTTCCAGCAGTCCCATATTC pLKO_005 552 CDS 100% 13.200 6.600 Y AMY2B n/a
6 TRCN0000056025 GCACATACTGTGATGTCATTT pLKO.1 1517 CDS 100% 13.200 6.600 Y AMY2A n/a
7 TRCN0000151403 GCACATACTGTGATGTCATTT pLKO.1 1517 CDS 100% 13.200 6.600 Y AMY1C n/a
8 TRCN0000055976 GCTACCGTTGGCCAAGATATT pLKO.1 1199 CDS 100% 13.200 6.600 Y AMY1A n/a
9 TRCN0000254837 TGGTTCCCGGAAGGTAGTAAA pLKO_005 838 CDS 100% 13.200 6.600 Y AMY1B n/a
10 TRCN0000254840 TTATGGATTTACACGAGTAAT pLKO_005 1173 CDS 100% 13.200 6.600 Y AMY1B n/a
11 TRCN0000056059 CCTGGAGACATAAAGGCAATT pLKO.1 787 CDS 100% 10.800 5.400 Y AMY2B n/a
12 TRCN0000154146 CCTGGAGACATAAAGGCAATT pLKO.1 787 CDS 100% 10.800 5.400 Y AMY1C n/a
13 TRCN0000055974 GCGTTCTAAGATTGCCGAATA pLKO.1 702 CDS 100% 10.800 5.400 Y AMY1A n/a
14 TRCN0000153008 GCGTTCTAAGATTGCCGAATA pLKO.1 702 CDS 100% 10.800 5.400 Y AMY1C n/a
15 TRCN0000055977 GCTCTTGAATGTGAGCGATAT pLKO.1 250 CDS 100% 10.800 5.400 Y AMY1A n/a
16 TRCN0000154291 GCTCTTGAATGTGAGCGATAT pLKO.1 250 CDS 100% 10.800 5.400 Y AMY1C n/a
17 TRCN0000347948 TGAACCATCTCATTGACATTG pLKO_005 725 CDS 100% 10.800 5.400 Y Amy2a3 n/a
18 TRCN0000153793 CACAACAAGGACGAACATCTA pLKO.1 194 CDS 100% 4.950 2.475 Y AMY1C n/a
19 TRCN0000055975 CCACCAAATGATAATGGAGTA pLKO.1 1255 CDS 100% 4.050 2.025 Y AMY1A n/a
20 TRCN0000152303 CCTTATGGATTTACACGAGTA pLKO.1 1171 CDS 100% 4.050 2.025 Y AMY1C n/a
21 TRCN0000056060 CGATGGGTTGATATTGCTCTT pLKO.1 235 CDS 100% 4.050 2.025 Y AMY2B n/a
22 TRCN0000154218 CGATGGGTTGATATTGCTCTT pLKO.1 235 CDS 100% 4.050 2.025 Y AMY1C n/a
23 TRCN0000056026 CGTATTTATGTGGATGCTGTA pLKO.1 451 CDS 100% 4.050 2.025 Y AMY2A n/a
24 TRCN0000056027 CGCCAAATAAGGAACATGGTT pLKO.1 1342 CDS 100% 3.000 1.500 Y AMY2A n/a
25 TRCN0000153737 CGCCAAATAAGGAACATGGTT pLKO.1 1342 CDS 100% 3.000 1.500 Y AMY1C n/a
26 TRCN0000150274 GTTCAGAATTGATGCTTCCAA pLKO.1 756 CDS 100% 3.000 1.500 Y AMY1B n/a
27 TRCN0000150595 GTTCAGAATTGATGCTTCCAA pLKO.1 756 CDS 100% 3.000 1.500 Y AMY1C n/a
28 TRCN0000056062 CCTTTCATTTACCAGGAGGTA pLKO.1 859 CDS 100% 2.640 1.320 Y AMY2B n/a
29 TRCN0000147333 GAACATGGTTAATTTCCGCAA pLKO.1 1353 CDS 100% 2.160 1.080 Y AMY1B n/a
30 TRCN0000158386 CCCGGAAGGTAGTAAACCTTT pLKO.1 843 CDS 100% 0.495 0.248 Y AMY1C n/a
31 TRCN0000055973 CGGAAGGTAGTAAACCTTTCA pLKO.1 845 CDS 100% 0.495 0.248 Y AMY1A n/a
32 TRCN0000254836 TACCAACCAGTTAGCTATAAA pLKO_005 361 CDS 100% 0.000 0.000 Y AMY1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001058.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00065 pDONR223 100% 97.6% 96.8% None (many diffs) n/a
2 ccsbBroad304_00065 pLX_304 0% 97.6% 96.8% V5 (many diffs) n/a
3 TRCN0000472453 AACGACGCGTATCCGTTCGTTCAA pLX_317 30.1% 97.6% 96.8% V5 (many diffs) n/a
4 ccsbBroadEn_05813 pDONR223 100% 97.6% 97.4% None (many diffs) n/a
5 ccsbBroad304_05813 pLX_304 0% 97.6% 97.4% V5 (many diffs) n/a
6 TRCN0000471163 CACTTCGGTCTGCGCATCTCCTTG pLX_317 27.3% 97.6% 97.4% V5 (many diffs) n/a
7 ccsbBroadEn_05812 pDONR223 100% 97.3% 97.4% None (many diffs) n/a
8 ccsbBroad304_05812 pLX_304 0% 97.3% 97.4% V5 (many diffs) n/a
9 TRCN0000472633 ACTCACATTAATATATTCTTGGCG pLX_317 30.1% 97.3% 97.4% V5 (many diffs) n/a
Download CSV