Transcript: Human XM_017001290.2

PREDICTED: Homo sapiens aryl hydrocarbon receptor nuclear translocator (ARNT), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARNT (405)
Length:
4297
CDS:
73..2370

Additional Resources:

NCBI RefSeq record:
XM_017001290.2
NBCI Gene record:
ARNT (405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001290.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356097 GGCTCAAGGAGATCGTTTATT pLKO_005 772 CDS 100% 15.000 21.000 N ARNT n/a
2 TRCN0000003816 GCCTACACTCTCCAACACAAT pLKO.1 1416 CDS 100% 4.950 3.960 N ARNT n/a
3 TRCN0000356098 ACTAGGTCCCACAGCTAATTT pLKO_005 1449 CDS 100% 15.000 10.500 N ARNT n/a
4 TRCN0000003818 CATTGTCCAGAGGGCTATTAA pLKO.1 150 CDS 100% 15.000 10.500 N ARNT n/a
5 TRCN0000003819 GAGAAGTCAGATGGTTTATTT pLKO.1 1627 CDS 100% 15.000 10.500 N ARNT n/a
6 TRCN0000356128 AGGGCGTATCCTGGATCTAAA pLKO_005 699 CDS 100% 13.200 9.240 N ARNT n/a
7 TRCN0000079929 CCAGACAAGCTAACCATCTTA pLKO.1 376 CDS 100% 5.625 3.938 N Arnt n/a
8 TRCN0000003820 AGCCTCATCATCGTTCAAGTT pLKO.1 2198 CDS 100% 4.950 3.465 N ARNT n/a
9 TRCN0000079932 CTGTAACCATTGTCCAGCCAT pLKO.1 1823 CDS 100% 2.640 1.848 N Arnt n/a
10 TRCN0000003817 CCTTTGTCTTTCTGTGTACTT pLKO.1 3003 3UTR 100% 4.950 2.970 N ARNT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001290.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10685 pDONR223 100% 49.3% 49.1% None (many diffs) n/a
2 ccsbBroad304_10685 pLX_304 0% 49.3% 49.1% V5 (many diffs) n/a
3 TRCN0000472968 GCATTATGGCTAACTTTTGTCCAC pLX_317 40.6% 49.3% 49.1% V5 (many diffs) n/a
Download CSV