Transcript: Human XM_017001301.1

PREDICTED: Homo sapiens lymphocyte antigen 9 (LY9), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LY9 (4063)
Length:
2421
CDS:
15..2009

Additional Resources:

NCBI RefSeq record:
XM_017001301.1
NBCI Gene record:
LY9 (4063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230028 CAACGGCAGATCCACTCATTA pLKO_005 904 CDS 100% 13.200 18.480 N LY9 n/a
2 TRCN0000218513 ATGCACAAGTGTTCAACTTAC pLKO_005 1822 CDS 100% 10.800 15.120 N LY9 n/a
3 TRCN0000230027 TGTTTAACACATCCATCATTA pLKO_005 862 CDS 100% 13.200 9.240 N LY9 n/a
4 TRCN0000230026 ATGATGCAGGATCCTACAAAG pLKO_005 385 CDS 100% 10.800 7.560 N LY9 n/a
5 TRCN0000152741 GAGAAGGTTGTCTGGTTGTTT pLKO.1 846 CDS 100% 5.625 3.938 N LY9 n/a
6 TRCN0000156788 GCCACAATCTACTGCTCCATA pLKO.1 1881 CDS 100% 4.950 3.465 N LY9 n/a
7 TRCN0000153301 GCCCAGATAAACCAAAGGAAT pLKO.1 405 CDS 100% 4.950 3.465 N LY9 n/a
8 TRCN0000157350 CTGGTGCATTTGGAAGCGAAA pLKO.1 1430 CDS 100% 4.050 2.835 N LY9 n/a
9 TRCN0000151090 GCTGCAAATATTCTCTTCTGT pLKO.1 86 CDS 100% 3.000 2.100 N LY9 n/a
10 TRCN0000157021 GCATCAGCAATCTGACTCTGA pLKO.1 364 CDS 100% 2.640 1.848 N LY9 n/a
11 TRCN0000157098 GTCATCTGGATTGGTCCCAAA pLKO.1 246 CDS 100% 4.050 2.430 N LY9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10954 pDONR223 100% 59.5% 57.6% None (many diffs) n/a
2 ccsbBroad304_10954 pLX_304 0% 59.5% 57.6% V5 (many diffs) n/a
3 TRCN0000471835 AACACCGTATATATTATCATCCCT pLX_317 33.2% 59.5% 57.6% V5 (many diffs) n/a
4 ccsbBroadEn_00953 pDONR223 100% 27% 24.8% None (many diffs) n/a
5 ccsbBroad304_00953 pLX_304 0% 27% 24.8% V5 (many diffs) n/a
6 TRCN0000471218 ACTTGCAAGGCCAGATGATACTCG pLX_317 77.2% 27% 24.8% V5 (many diffs) n/a
Download CSV