Transcript: Human XM_017001315.1

PREDICTED: Homo sapiens myocyte enhancer factor 2D (MEF2D), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MEF2D (4209)
Length:
5690
CDS:
228..1772

Additional Resources:

NCBI RefSeq record:
XM_017001315.1
NBCI Gene record:
MEF2D (4209)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001315.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015894 CGGCTTGATACCTGGACATTA pLKO.1 1746 CDS 100% 13.200 18.480 N MEF2D n/a
2 TRCN0000274112 GTCCTGTTGACGGTTACATTT pLKO_005 1889 3UTR 100% 13.200 18.480 N MEF2D n/a
3 TRCN0000274052 TCTGTGGCAACGCCGAGTTTA pLKO_005 1143 CDS 100% 13.200 18.480 N MEF2D n/a
4 TRCN0000015893 CCTCTGAAGAACTGGGCATTT pLKO.1 4855 3UTR 100% 10.800 7.560 N MEF2D n/a
5 TRCN0000274055 GGTCTCCCAGTCTACTCATTC pLKO_005 1103 CDS 100% 10.800 7.560 N MEF2D n/a
6 TRCN0000085271 CAATGGCAACAGCCTAAACAA pLKO.1 941 CDS 100% 5.625 3.938 N Mef2d n/a
7 TRCN0000015895 CCTCCTTACCAGCCTTTAGTT pLKO.1 1240 CDS 100% 5.625 3.938 N MEF2D n/a
8 TRCN0000085270 CACATCAGCATCAAGTCAGAA pLKO.1 1509 CDS 100% 4.950 3.465 N Mef2d n/a
9 TRCN0000015897 CAACAGCCTAAACAAGGTCAT pLKO.1 947 CDS 100% 4.050 2.835 N MEF2D n/a
10 TRCN0000274054 CAACAGCCTAAACAAGGTCAT pLKO_005 947 CDS 100% 4.050 2.835 N MEF2D n/a
11 TRCN0000015896 CTGAGGAAGAAGGGCTTCAAT pLKO.1 489 CDS 100% 5.625 3.938 N MEF2D n/a
12 TRCN0000085272 CCCTGGTGACATCATCCCTTA pLKO.1 727 CDS 100% 4.050 2.835 N Mef2d n/a
13 TRCN0000349137 CCCTGGTGACATCATCCCTTA pLKO_005 727 CDS 100% 4.050 2.835 N Mef2d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001315.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00997 pDONR223 100% 98.5% 98.6% None 282C>T;756A>G;853_854ins21 n/a
2 ccsbBroad304_00997 pLX_304 0% 98.5% 98.6% V5 282C>T;756A>G;853_854ins21 n/a
3 TRCN0000478896 TCTCGTATATTATACATCGTACAC pLX_317 23.4% 98.5% 98.6% V5 282C>T;756A>G;853_854ins21 n/a
Download CSV