Transcript: Human XM_017001467.2

PREDICTED: Homo sapiens PDZ domain containing 1 (PDZK1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDZK1 (5174)
Length:
2150
CDS:
755..1693

Additional Resources:

NCBI RefSeq record:
XM_017001467.2
NBCI Gene record:
PDZK1 (5174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001467.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059670 CTTAGGATCAATGGTGTCTTT pLKO.1 436 5UTR 100% 4.950 3.960 N PDZK1 n/a
2 TRCN0000434976 CTTCAACTTAACTTAACTACA pLKO_005 1950 3UTR 100% 4.950 3.465 N PDZK1 n/a
3 TRCN0000412364 TGTAAACTGTCCAAGCAAGAA pLKO_005 298 5UTR 100% 4.950 3.465 N PDZK1 n/a
4 TRCN0000059668 GCAAGGTTTGAGTGATAATAT pLKO.1 603 5UTR 100% 15.000 7.500 Y PDZK1 n/a
5 TRCN0000059672 GCTCAGAACAGAAAGGTCAAA pLKO.1 912 CDS 100% 4.950 2.475 Y PDZK1 n/a
6 TRCN0000059669 CCTATGATTATTTCCAAGCTA pLKO.1 1509 CDS 100% 3.000 1.500 Y PDZK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001467.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01170 pDONR223 100% 60.1% 60.1% None 0_1ins621 n/a
2 ccsbBroad304_01170 pLX_304 0% 60.1% 60.1% V5 0_1ins621 n/a
3 TRCN0000467953 GCAACCCAGAAGGATTGTCTCAGG pLX_317 23.9% 60.1% 60.1% V5 0_1ins621 n/a
Download CSV