Transcript: Human XM_017001486.1

PREDICTED: Homo sapiens phosphatidylinositol 4-kinase beta (PI4KB), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PI4KB (5298)
Length:
4307
CDS:
791..3259

Additional Resources:

NCBI RefSeq record:
XM_017001486.1
NBCI Gene record:
PI4KB (5298)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005695 CGACATGTTCAACTACTATAA pLKO.1 2914 CDS 100% 13.200 18.480 N PI4KB n/a
2 TRCN0000199916 GATGGCAGTATGCGGTCTATC pLKO.1 3188 CDS 100% 10.800 15.120 N PI4KB n/a
3 TRCN0000197011 GAGATCCGTTGCCTAGATGAT pLKO.1 1046 CDS 100% 4.950 6.930 N PI4KB n/a
4 TRCN0000005692 TCTCGGTACTTAGGACTTGAT pLKO.1 3661 3UTR 100% 4.950 6.930 N PI4KB n/a
5 TRCN0000199262 CCACAGGCCATCCTCTTATTC pLKO.1 3606 3UTR 100% 13.200 9.240 N PI4KB n/a
6 TRCN0000005696 CCAGTTGCTTAACATGTACAT pLKO.1 1321 CDS 100% 4.950 3.465 N PI4KB n/a
7 TRCN0000342668 CCAGTTGCTTAACATGTACAT pLKO_005 1321 CDS 100% 4.950 3.465 N PI4KB n/a
8 TRCN0000005693 CCATACAAGATTCTTGTGATT pLKO.1 2534 CDS 100% 4.950 3.465 N PI4KB n/a
9 TRCN0000197169 GCAAGAAACACGAAGGATCAT pLKO.1 3381 3UTR 100% 4.950 3.465 N PI4KB n/a
10 TRCN0000342669 GCAAGAAACACGAAGGATCAT pLKO_005 3381 3UTR 100% 4.950 3.465 N PI4KB n/a
11 TRCN0000024763 CCTCAAAGAGAGGTTCCACAT pLKO.1 3121 CDS 100% 4.050 2.835 N Pi4kb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14765 pDONR223 0% 97.4% 97.4% None 786C>T;2225_2287del n/a
2 ccsbBroad304_14765 pLX_304 0% 97.4% 97.4% V5 786C>T;2225_2287del n/a
3 TRCN0000473408 CAGAGCACTGGTTGCCGACCCGAG pLX_317 16.6% 97.3% 97.3% V5 786C>T;2225_2287del;2459G>A n/a
4 TRCN0000489811 TGACGCCTGTCAGCCCGTTTCTCG pLX_317 16.4% 97.2% 97.3% V5 (not translated due to prior stop codon) 786C>T;2225_2287del;2466_2467insGTG n/a
Download CSV