Transcript: Human XM_017001635.1

PREDICTED: Homo sapiens proton activated chloride channel 1 (PACC1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PACC1 (55248)
Length:
2335
CDS:
752..1594

Additional Resources:

NCBI RefSeq record:
XM_017001635.1
NBCI Gene record:
PACC1 (55248)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001635.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285381 GAAGTCACCTCGCGTTGTTTA pLKO_005 1593 CDS 100% 13.200 18.480 N PACC1 n/a
2 TRCN0000136154 GAACAAGAGTAGTGAGGACTT pLKO.1 1108 CDS 100% 4.050 5.670 N PACC1 n/a
3 TRCN0000275465 GAACAAGAGTAGTGAGGACTT pLKO_005 1108 CDS 100% 4.050 5.670 N PACC1 n/a
4 TRCN0000275464 GTTTGCCAAACTGAGTATAAA pLKO_005 1507 CDS 100% 15.000 10.500 N PACC1 n/a
5 TRCN0000135806 CCACTTTGTAAACGGAGCTAT pLKO.1 1650 3UTR 100% 4.950 3.465 N PACC1 n/a
6 TRCN0000285384 CCACTTTGTAAACGGAGCTAT pLKO_005 1650 3UTR 100% 4.950 3.465 N PACC1 n/a
7 TRCN0000135119 CCAAGATATAGTCACTGCCAA pLKO.1 1426 CDS 100% 2.640 1.848 N PACC1 n/a
8 TRCN0000138238 CCTGAACAAGAGTAGTGAGGA pLKO.1 1105 CDS 100% 2.640 1.848 N PACC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001635.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03561 pDONR223 100% 80% 80% None 129_130ins210 n/a
2 ccsbBroad304_03561 pLX_304 0% 80% 80% V5 129_130ins210 n/a
3 TRCN0000467460 CCCAGTGGGGTCCGGGTCAACTCG pLX_317 41.7% 80% 80% V5 129_130ins210 n/a
Download CSV