Transcript: Human XM_017001866.2

PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase IG (CAMK1G), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAMK1G (57172)
Length:
2613
CDS:
246..1676

Additional Resources:

NCBI RefSeq record:
XM_017001866.2
NBCI Gene record:
CAMK1G (57172)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146460 AGCGTCTACTCACAATATGT pXPR_003 AGG 631 44% 7 1.25 CAMK1G CAMK1G 75986
2 BRDN0001147776 GGACGATGCCATTCTCATGT pXPR_003 AGG 404 28% 5 0.992 CAMK1G CAMK1G 75985
3 BRDN0001148530 ACTTTGCTAAGAGCAAGTGG pXPR_003 AGG 909 64% 10 0.7737 CAMK1G CAMK1G 75984
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001866.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001452 ATATTCAACTCCTCTGCTCTT pLKO.1 1719 3UTR 100% 4.050 5.670 N CAMK1G n/a
2 TRCN0000197155 GCAAAGGAAAGTCCTCCTACT pLKO.1 1525 CDS 100% 4.050 5.670 N CAMK1G n/a
3 TRCN0000231674 GAGTCAGCCAAGGACTTTATT pLKO_005 987 CDS 100% 15.000 10.500 N CAMK1G n/a
4 TRCN0000195411 CATCGTCCACAGAGACTTAAA pLKO.1 659 CDS 100% 13.200 9.240 N CAMK1G n/a
5 TRCN0000231671 CGGCGTCATCACCTACATATT pLKO_005 860 CDS 100% 13.200 9.240 N CAMK1G n/a
6 TRCN0000196940 GCCAGATTGGGCTCATTAATG pLKO.1 2155 3UTR 100% 13.200 9.240 N CAMK1G n/a
7 TRCN0000231675 TAACCTTGGAAGTTGACTATT pLKO_005 2437 3UTR 100% 13.200 9.240 N CAMK1G n/a
8 TRCN0000194858 CTTCAAGTTCTAATCCTTAAC pLKO.1 2237 3UTR 100% 10.800 7.560 N CAMK1G n/a
9 TRCN0000231672 TATGAAGAAACGGAGTCTAAG pLKO_005 903 CDS 100% 10.800 7.560 N CAMK1G n/a
10 TRCN0000001453 CCTCCAGATCCAGAAGAACTT pLKO.1 1121 CDS 100% 4.950 3.465 N CAMK1G n/a
11 TRCN0000024347 GAAGAAACAGACCACCAACAT pLKO.1 281 CDS 100% 4.950 3.465 N Camk1g n/a
12 TRCN0000001456 GAAGATCAAGGAGGGCTACTA pLKO.1 932 CDS 100% 4.950 3.465 N CAMK1G n/a
13 TRCN0000001454 GTGAAATACCTACATGAGAAT pLKO.1 636 CDS 100% 4.950 3.465 N CAMK1G n/a
14 TRCN0000001455 GACTTTATTTGCCACTTGCTT pLKO.1 999 CDS 100% 3.000 2.100 N CAMK1G n/a
15 TRCN0000231673 CTCCATTCTGGGATGACATTT pLKO_005 964 CDS 100% 13.200 7.920 N CAMK1G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001866.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08716 pDONR223 100% 99.9% 100% None 654A>G n/a
2 ccsbBroad304_08716 pLX_304 0% 99.9% 100% V5 654A>G n/a
3 TRCN0000480192 GCCGACGCGCCTATTTATCTAAAC pLX_317 28.5% 99.9% 100% V5 654A>G n/a
4 ccsbBroadEn_15122 pDONR223 0% 99.9% 100% None 654A>G n/a
5 ccsbBroad304_15122 pLX_304 0% 99.9% 100% V5 654A>G n/a
6 TRCN0000489614 GCGCCCCAGGGCCCTTGACTTACG pLX_317 24.7% 99.9% 99.7% V5 (not translated due to prior stop codon) 807G>C n/a
Download CSV