Transcript: Human XM_017001909.1

PREDICTED: Homo sapiens adhesion G protein-coupled receptor B2 (ADGRB2), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRB2 (576)
Length:
5276
CDS:
426..4961

Additional Resources:

NCBI RefSeq record:
XM_017001909.1
NBCI Gene record:
ADGRB2 (576)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008121 GAGCGAAAGAAATTACGGTAT pLKO.1 4638 CDS 100% 4.050 5.670 N ADGRB2 n/a
2 TRCN0000342796 GAGCGAAAGAAATTACGGTAT pLKO_005 4638 CDS 100% 4.050 5.670 N ADGRB2 n/a
3 TRCN0000008117 GACTGCCCACTGCATATAAAT pLKO.1 4973 3UTR 100% 15.000 10.500 N ADGRB2 n/a
4 TRCN0000342866 GACTGCCCACTGCATATAAAT pLKO_005 4973 3UTR 100% 15.000 10.500 N ADGRB2 n/a
5 TRCN0000426967 ACCACTACCTGGTCAACTTTA pLKO_005 727 CDS 100% 13.200 9.240 N Adgrb2 n/a
6 TRCN0000008119 GCCTATGGATCTCTCCAGAAT pLKO.1 4491 CDS 100% 4.950 3.465 N ADGRB2 n/a
7 TRCN0000008120 GCTACCTGTATCTGTCACTTA pLKO.1 2038 CDS 100% 4.950 3.465 N ADGRB2 n/a
8 TRCN0000342863 GCTACCTGTATCTGTCACTTA pLKO_005 2038 CDS 100% 4.950 3.465 N ADGRB2 n/a
9 TRCN0000008118 GCTCTCTGATTGTCACAGATA pLKO.1 2401 CDS 100% 4.950 3.465 N ADGRB2 n/a
10 TRCN0000342795 GCTCTCTGATTGTCACAGATA pLKO_005 2401 CDS 100% 4.950 3.465 N ADGRB2 n/a
11 TRCN0000415485 TGCACTTCGACAAGAACTTTG pLKO_005 877 CDS 100% 10.800 7.560 N Adgrb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489289 GCCGTAGACCGTAGGTACGATGTC pLX_317 7.6% 95.2% 95.2% V5 (many diffs) n/a
2 TRCN0000488242 GACCACCCAAAAAAGACTATCCAT pLX_317 7.4% 95.2% 95.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV