Transcript: Human XM_017002199.2

PREDICTED: Homo sapiens contactin 2 (CNTN2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNTN2 (6900)
Length:
8228
CDS:
541..4089

Additional Resources:

NCBI RefSeq record:
XM_017002199.2
NBCI Gene record:
CNTN2 (6900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002199.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433342 GTCTGCAGTCACCGGCTATAA pLKO_005 3348 CDS 100% 13.200 10.560 N CNTN2 n/a
2 TRCN0000414028 TGGCCATGCCCTGGTACAAAT pLKO_005 3456 CDS 100% 13.200 10.560 N CNTN2 n/a
3 TRCN0000005788 CCGGTCAGATGAAGGCAAATA pLKO.1 1962 CDS 100% 13.200 9.240 N CNTN2 n/a
4 TRCN0000005787 CGGCAAGAACTGGATAGAAAT pLKO.1 3417 CDS 100% 13.200 9.240 N CNTN2 n/a
5 TRCN0000005789 GCAGCAGGACATGAATGGTAT pLKO.1 3033 CDS 100% 4.950 3.465 N CNTN2 n/a
6 TRCN0000005786 GCAGAATTTGTTTGAGGGATA pLKO.1 6423 3UTR 100% 4.050 2.835 N CNTN2 n/a
7 TRCN0000010966 GCTGAGAACTTCATGGGCAAA pLKO.1 1993 CDS 100% 4.050 2.835 N CNTN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002199.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07032 pDONR223 100% 85.7% 81.1% None (many diffs) n/a
2 ccsbBroad304_07032 pLX_304 0% 85.7% 81.1% V5 (many diffs) n/a
3 TRCN0000471080 GGATTTCCTACCACAATTAACATC pLX_317 6.6% 85.7% 81.1% V5 (many diffs) n/a
Download CSV