Transcript: Human XM_017002216.2

PREDICTED: Homo sapiens troponin T2, cardiac type (TNNT2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNNT2 (7139)
Length:
1132
CDS:
73..936

Additional Resources:

NCBI RefSeq record:
XM_017002216.2
NBCI Gene record:
TNNT2 (7139)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083643 CGATAACCAGAAAGTCTCCAA pLKO.1 876 CDS 100% 2.640 3.696 N TNNT2 n/a
2 TRCN0000426463 GAGATCAATGTTCTCCGAAAC pLKO_005 847 CDS 100% 6.000 4.800 N TNNT2 n/a
3 TRCN0000416744 ACCAAAGCCCAGGTCGTTCAT pLKO_005 264 CDS 100% 4.950 3.465 N TNNT2 n/a
4 TRCN0000083647 CGATGGAGAGAGAGTGGACTT pLKO.1 312 CDS 100% 4.050 2.835 N TNNT2 n/a
5 TRCN0000421488 GACCACCTGAATGAAGATCAG pLKO_005 733 CDS 100% 4.050 2.835 N TNNT2 n/a
6 TRCN0000415600 TCAAAGACAGGATCGAGAGAC pLKO_005 440 CDS 100% 4.050 2.835 N TNNT2 n/a
7 TRCN0000083646 GCAGAGCATCTATAACTTGGA pLKO.1 780 CDS 100% 2.640 1.848 N TNNT2 n/a
8 TRCN0000083645 GAAGGCTTTGTCCAACATGAT pLKO.1 597 CDS 100% 4.950 2.970 N TNNT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01693 pDONR223 100% 99.3% 99.3% None 569_574delAGGCCC n/a
2 ccsbBroad304_01693 pLX_304 0% 99.3% 99.3% V5 569_574delAGGCCC n/a
3 TRCN0000492217 GTGCTGCGACTTACACACAATCTC pLX_317 47.3% 99.1% 99.3% V5 569_574delAGGCCC;861A>G n/a
Download CSV