Transcript: Human XM_017002238.1

PREDICTED: Homo sapiens zinc finger and SCAN domain containing 20 (ZSCAN20), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZSCAN20 (7579)
Length:
12059
CDS:
154..3282

Additional Resources:

NCBI RefSeq record:
XM_017002238.1
NBCI Gene record:
ZSCAN20 (7579)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002238.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435212 CTTACGAGATTAGAGTTAAAT pLKO_005 3570 3UTR 100% 15.000 21.000 N ZSCAN20 n/a
2 TRCN0000014901 CCTTCAACCTTGTGTCCTAAA pLKO.1 1990 CDS 100% 10.800 8.640 N ZSCAN20 n/a
3 TRCN0000434480 GACCTTCCCAATCACCTAAAT pLKO_005 703 CDS 100% 13.200 9.240 N ZSCAN20 n/a
4 TRCN0000014900 CCAAGTAATACCTCCGAGAAA pLKO.1 937 CDS 100% 4.950 3.465 N ZSCAN20 n/a
5 TRCN0000014898 CCAGGTAATTTGGAAGTGAAT pLKO.1 3409 3UTR 100% 4.950 3.465 N ZSCAN20 n/a
6 TRCN0000014902 CGTGACCGTTCTAACCTCATT pLKO.1 3055 CDS 100% 4.950 3.465 N ZSCAN20 n/a
7 TRCN0000014899 GCCTGGTCAATGTTGAGTCTA pLKO.1 1526 CDS 100% 4.950 3.465 N ZSCAN20 n/a
8 TRCN0000428902 CAACCTCAAAGTATCAGTAAG pLKO_005 2704 CDS 100% 10.800 6.480 N ZSCAN20 n/a
9 TRCN0000234230 ACTGGAGAGAAGCCCTATAAA pLKO_005 2431 CDS 100% 15.000 7.500 Y EG666702 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 11192 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 11192 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002238.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11230 pDONR223 100% 41.3% 41% None (many diffs) n/a
2 ccsbBroad304_11230 pLX_304 0% 41.3% 41% V5 (many diffs) n/a
3 TRCN0000479836 ACTCTCGAAGTCTGCCGATTTTTT pLX_317 24.4% 41.2% 41% V5 (many diffs) n/a
Download CSV