Transcript: Human XM_017002430.2

PREDICTED: Homo sapiens capping actin protein of muscle Z-line subunit beta (CAPZB), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAPZB (832)
Length:
453
CDS:
20..439

Additional Resources:

NCBI RefSeq record:
XM_017002430.2
NBCI Gene record:
CAPZB (832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002430.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029345 CCTATAGGTCACCATGGAGTA pLKO.1 315 CDS 100% 4.050 2.835 N CAPZB n/a
2 TRCN0000029347 GACCAGTATCGAGACCTGTAT pLKO.1 419 CDS 100% 4.950 6.930 N CAPZB n/a
3 TRCN0000318894 GACCAGTATCGAGACCTGTAT pLKO_005 419 CDS 100% 4.950 6.930 N CAPZB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002430.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00218 pDONR223 100% 36.5% 36.2% None 1_85del;88_89delCA;417_418ins486 n/a
2 ccsbBroad304_00218 pLX_304 0% 36.5% 36.2% V5 1_85del;88_89delCA;417_418ins486 n/a
3 TRCN0000472378 GTTACTGCGCTTCTCCCTAGTCGT pLX_317 55.5% 36.5% 36.2% V5 1_85del;88_89delCA;417_418ins486 n/a
Download CSV