Transcript: Human XM_017002597.2

PREDICTED: Homo sapiens ATP/GTP binding protein like 4 (AGBL4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGBL4 (84871)
Length:
2977
CDS:
118..1512

Additional Resources:

NCBI RefSeq record:
XM_017002597.2
NBCI Gene record:
AGBL4 (84871)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002597.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429661 TTGACCGAGAAGAAGATATTT pLKO_005 578 CDS 100% 15.000 10.500 N AGBL4 n/a
2 TRCN0000254793 CTACACTGAAGAAGCCTATAT pLKO_005 1368 CDS 100% 13.200 9.240 N Agbl4 n/a
3 TRCN0000418508 TGCTTACTGCTACCCATATAC pLKO_005 606 CDS 100% 13.200 9.240 N AGBL4 n/a
4 TRCN0000073901 GAAACAACTCATCGTCCAGAT pLKO.1 1035 CDS 100% 4.050 2.835 N AGBL4 n/a
5 TRCN0000073902 ACAGGTGTTCTCTGATGGGAT pLKO.1 953 CDS 100% 2.640 1.848 N AGBL4 n/a
6 TRCN0000222592 CCCTCATCATTTGTGTGCCAA pLKO.1 820 CDS 100% 2.640 1.848 N AGBL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002597.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12867 pDONR223 100% 54.2% 52.1% None (many diffs) n/a
2 ccsbBroad304_12867 pLX_304 0% 54.2% 52.1% V5 (many diffs) n/a
3 TRCN0000465668 TAATGTTGACCACCACCGTGTAGT pLX_317 35.6% 54.2% 52.1% V5 (many diffs) n/a
Download CSV