Transcript: Human XM_017002601.2

PREDICTED: Homo sapiens autophagy related 4C cysteine peptidase (ATG4C), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATG4C (84938)
Length:
2543
CDS:
179..1435

Additional Resources:

NCBI RefSeq record:
XM_017002601.2
NBCI Gene record:
ATG4C (84938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002601.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432247 GCGAAATGAAGTTTATCATAG pLKO_005 751 CDS 100% 10.800 8.640 N ATG4C n/a
2 TRCN0000414674 GATGACAAAGCTGTTATTATT pLKO_005 1031 CDS 100% 15.000 10.500 N ATG4C n/a
3 TRCN0000414876 ATCCTGATTTACAAGGAATAA pLKO_005 927 CDS 100% 13.200 9.240 N ATG4C n/a
4 TRCN0000073804 CCTGGCCTGATGCTTTGAATA pLKO.1 579 CDS 100% 13.200 9.240 N ATG4C n/a
5 TRCN0000428748 TCATTCCAGAGACTATGATTT pLKO_005 1321 CDS 100% 13.200 9.240 N ATG4C n/a
6 TRCN0000417090 TGCACAAGATTGTACAGTTTA pLKO_005 958 CDS 100% 13.200 9.240 N ATG4C n/a
7 TRCN0000030948 GAAATATAGTTGGGTGTTGAA pLKO.1 247 CDS 100% 4.950 3.465 N Atg4c n/a
8 TRCN0000073807 GCATCATTTGAAGCATCACTT pLKO.1 653 CDS 100% 4.950 3.465 N ATG4C n/a
9 TRCN0000073806 CCTGGAATATTGTGTGGGTAT pLKO.1 1123 CDS 100% 4.050 2.835 N ATG4C n/a
10 TRCN0000073805 GCCTGGAATATTGTGTGGGTA pLKO.1 1122 CDS 100% 2.640 1.848 N ATG4C n/a
11 TRCN0000073803 GCTTGATAAGAAGAATTCCAT pLKO.1 1452 3UTR 100% 0.000 0.000 N ATG4C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002601.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04451 pDONR223 100% 91.2% 91.2% None 1087_1088ins120 n/a
2 ccsbBroad304_04451 pLX_304 0% 91.2% 91.2% V5 1087_1088ins120 n/a
3 TRCN0000467723 CTCGGAATCATCGAAAGATTCCTT pLX_317 27.7% 91.2% 91.2% V5 1087_1088ins120 n/a
Download CSV