Transcript: Human XM_017002720.1

PREDICTED: Homo sapiens TNF receptor superfamily member 14 (TNFRSF14), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNFRSF14 (8764)
Length:
2426
CDS:
1271..1870

Additional Resources:

NCBI RefSeq record:
XM_017002720.1
NBCI Gene record:
TNFRSF14 (8764)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059169 CAGTCCAGGTTATCGTGTGAA pLKO.1 247 5UTR 100% 4.950 6.930 N TNFRSF14 n/a
2 TRCN0000416770 GGGTGATGTAGTCAAGGTGAT pLKO_005 1711 CDS 100% 4.050 5.670 N TNFRSF14 n/a
3 TRCN0000059170 CTCCACAGTTGGCCTAATCAT pLKO.1 1666 CDS 100% 5.625 3.938 N TNFRSF14 n/a
4 TRCN0000059168 GCCTCGTCATCGTCATTGTTT pLKO.1 1644 CDS 100% 5.625 3.938 N TNFRSF14 n/a
5 TRCN0000416111 TCCCACTGGGTATGGTGGTTT pLKO_005 1613 CDS 100% 4.950 3.465 N TNFRSF14 n/a
6 TRCN0000059172 TGGAGGAGACAATACCCTCAT pLKO.1 1824 CDS 100% 4.050 2.835 N TNFRSF14 n/a
7 TRCN0000059171 GCTGGTGCTGTATCTCACCTT pLKO.1 142 5UTR 100% 2.640 1.848 N TNFRSF14 n/a
8 TRCN0000419201 ATGTCAGCACCAGACCAAGTG pLKO_005 1552 CDS 100% 4.050 2.430 N TNFRSF14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroad304_07295 pLX_304 68.1% 68.6% 66% V5 (many diffs) n/a
2 TRCN0000480267 ACTTAAAATATATCTTCATAGTGC pLX_317 49.5% 68.6% 66% V5 (many diffs) n/a
3 ccsbBroadEn_07295 pDONR223 100% 68.5% 65.7% None (many diffs) n/a
4 TRCN0000489269 GATCGCCCAGCTGTTAGGCCCAGC pLX_317 49.6% 68.6% 66% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV