Transcript: Human XM_017002772.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 6 (MAP3K6), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K6 (9064)
Length:
3899
CDS:
1441..3846

Additional Resources:

NCBI RefSeq record:
XM_017002772.1
NBCI Gene record:
MAP3K6 (9064)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001162255 GGGCCGCGATCGCCACACGA pXPR_003 GGG 2008 83% 15 1.1261 MAP3K6 MAP3K6 76012
2 BRDN0001144737 CAGTGGCCGTCACCACATAG pXPR_003 GGG 536 22% 4 0.7507 MAP3K6 MAP3K6 76013
3 BRDN0001162229 TCTGGATGCCTTCTACAACG pXPR_003 CGG 334 14% 1 0.3397 MAP3K6 MAP3K6 76015
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002345 CGTGGAGAAGATGCAGTATTA pLKO.1 2733 CDS 100% 13.200 9.240 N MAP3K6 n/a
2 TRCN0000352611 CGTGGAGAAGATGCAGTATTA pLKO_005 2733 CDS 100% 13.200 9.240 N MAP3K6 n/a
3 TRCN0000197175 GCTTCAGCATGACCAACAATG pLKO.1 1853 CDS 100% 10.800 7.560 N MAP3K6 n/a
4 TRCN0000002343 GTTGGAGTTTGATTATGAGTA pLKO.1 3354 CDS 100% 4.950 3.465 N MAP3K6 n/a
5 TRCN0000352677 GTTGGAGTTTGATTATGAGTA pLKO_005 3354 CDS 100% 4.950 3.465 N MAP3K6 n/a
6 TRCN0000002344 CATGTTCTTCAGCTCGGGTTT pLKO.1 2526 CDS 100% 4.050 2.835 N MAP3K6 n/a
7 TRCN0000002342 CAACCATTCAAGACAGCCTGT pLKO.1 2977 CDS 100% 2.160 1.512 N MAP3K6 n/a
8 TRCN0000126745 GCCTGCATATCGAACCTTTAT pLKO.1 831 5UTR 100% 13.200 6.600 Y Utp15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11332 pDONR223 100% 47.1% 46.9% None 1_831del;2320_2356del;2403_2404ins856 n/a
2 ccsbBroad304_11332 pLX_304 0% 47.1% 46.9% V5 1_831del;2320_2356del;2403_2404ins856 n/a
3 TRCN0000481050 TGATCAGTTTTTGCCATGAGCGTT pLX_317 11.9% 47.1% 46.9% V5 1_831del;2320_2356del;2403_2404ins856 n/a
4 ccsbBroadEn_14926 pDONR223 0% 47.1% 46.9% None 1_831del;2320_2356del;2403_2404ins856 n/a
5 ccsbBroad304_14926 pLX_304 0% 47.1% 46.9% V5 1_831del;2320_2356del;2403_2404ins856 n/a
6 TRCN0000465376 CGCAATTACCGCCGTCAACACTGT pLX_317 11.6% 47.1% 46.9% V5 1_831del;2320_2356del;2403_2404ins856 n/a
Download CSV