Transcript: Human XM_017003103.2

PREDICTED: Homo sapiens LIM zinc finger domain containing 4 (LIMS4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LIMS4 (100288695)
Length:
1182
CDS:
4..1167

Additional Resources:

NCBI RefSeq record:
XM_017003103.2
NBCI Gene record:
LIMS4 (100288695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149648 GAGACGATCGTGAACAGTAAT pLKO.1 250 CDS 100% 13.200 6.600 Y LIMS3 n/a
2 TRCN0000059042 CGAGTTATCAAAGCCATGAAT pLKO.1 430 CDS 100% 5.625 2.813 Y LIMS1 n/a
3 TRCN0000148822 CAGTGACGTGAAAGTCTACAA pLKO.1 138 CDS 100% 4.950 2.475 Y LIMS3 n/a
4 TRCN0000059041 CCCTGTCATAATCGTGAGAAA pLKO.1 547 CDS 100% 4.950 2.475 Y LIMS1 n/a
5 TRCN0000148598 CTACAAGGAGTTCTGTGACTT pLKO.1 153 CDS 100% 4.950 2.475 Y LIMS3 n/a
6 TRCN0000149869 CGTGAAAGTCTACAAGGAGTT pLKO.1 144 CDS 100% 4.050 2.025 Y LIMS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06524 pDONR223 100% 75.9% 70.7% None (many diffs) n/a
2 ccsbBroad304_06524 pLX_304 0% 75.9% 70.7% V5 (many diffs) n/a
3 TRCN0000468941 TAGATCCTATTATCCCACTCTTGT pLX_317 39.8% 75.9% 70.7% V5 (many diffs) n/a
4 ccsbBroadEn_04624 pDONR223 100% 30% 29.4% None (many diffs) n/a
5 ccsbBroad304_04624 pLX_304 0% 30% 29.4% V5 (many diffs) n/a
6 TRCN0000469496 CCTGCACGGGACAGCCCGTCTAAT pLX_317 100% 30% 29.4% V5 (many diffs) n/a
Download CSV