Transcript: Human XM_017003539.2

PREDICTED: Homo sapiens dystrobrevin beta (DTNB), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DTNB (1838)
Length:
2246
CDS:
536..1906

Additional Resources:

NCBI RefSeq record:
XM_017003539.2
NBCI Gene record:
DTNB (1838)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003539.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054201 GCAGAGAAAGATAATGCTAAA pLKO.1 694 CDS 100% 10.800 15.120 N DTNB n/a
2 TRCN0000108761 GCCATGCAATTAGTAAATCTT pLKO.1 993 CDS 100% 5.625 7.875 N Dtnb n/a
3 TRCN0000054202 CACCGTCTTATAGCTCGCTAT pLKO.1 1208 CDS 100% 4.050 5.670 N DTNB n/a
4 TRCN0000433001 GTCATACGACTATCAACTTAC pLKO_005 265 5UTR 100% 10.800 8.640 N DTNB n/a
5 TRCN0000412626 TCCAATGGCTTAATGATATTT pLKO_005 566 CDS 100% 15.000 10.500 N DTNB n/a
6 TRCN0000416464 CTGAGCCATGCAATTAGTAAA pLKO_005 989 CDS 100% 13.200 9.240 N DTNB n/a
7 TRCN0000429415 ATTAGTGTGGAACAATCTATC pLKO_005 484 5UTR 100% 10.800 7.560 N DTNB n/a
8 TRCN0000054200 GCAACCTTCATCTTGTTGATA pLKO.1 323 5UTR 100% 5.625 3.938 N DTNB n/a
9 TRCN0000054198 GCCTGCAAATTACGATTTGTA pLKO.1 292 5UTR 100% 0.563 0.394 N DTNB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003539.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00465 pDONR223 100% 68.3% 68.3% None (many diffs) n/a
2 ccsbBroad304_00465 pLX_304 0% 68.3% 68.3% V5 (many diffs) n/a
3 TRCN0000470172 TAGCTCTCCGCGAGATGAGTTAGG pLX_317 25.2% 68.3% 68.3% V5 (many diffs) n/a
Download CSV