Transcript: Human XM_017003677.2

PREDICTED: Homo sapiens cytoplasmic linker associated protein 1 (CLASP1), transcript variant X27, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLASP1 (23332)
Length:
8825
CDS:
1889..5740

Additional Resources:

NCBI RefSeq record:
XM_017003677.2
NBCI Gene record:
CLASP1 (23332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113934 CCCTAGGTTAATACCTGTCAT pLKO.1 2518 CDS 100% 4.950 6.930 N CLASP1 n/a
2 TRCN0000113931 CCCTTTATTTATCAAGCGTAA pLKO.1 8433 3UTR 100% 4.050 5.670 N CLASP1 n/a
3 TRCN0000414231 GATCTGAATGAGCCAATTAAA pLKO_005 4718 CDS 100% 15.000 10.500 N CLASP1 n/a
4 TRCN0000265376 CCATTATGCCAACTATCTTTA pLKO_005 2418 CDS 100% 13.200 9.240 N Clasp1 n/a
5 TRCN0000113932 GCAGAGAGTAAATGCTCTAAA pLKO.1 2209 CDS 100% 13.200 9.240 N CLASP1 n/a
6 TRCN0000417514 GTTTGCTCTGAGCGCTCATAT pLKO_005 3740 CDS 100% 13.200 9.240 N CLASP1 n/a
7 TRCN0000113933 CCTGAATTTACCATGTTACTT pLKO.1 4406 CDS 100% 5.625 3.938 N CLASP1 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 27 5UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 27 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11720 pDONR223 100% 11.6% 11.6% None 1_3402del n/a
2 ccsbBroad304_11720 pLX_304 0% 11.6% 11.6% V5 1_3402del n/a
3 TRCN0000474886 TTTTTTTCCCTTTGGCCTCGACAC pLX_317 89% 11.6% 11.6% V5 1_3402del n/a
Download CSV