Transcript: Human XM_017003739.2

PREDICTED: Homo sapiens transmembrane protein with EGF like and two follistatin like domains 2 (TMEFF2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEFF2 (23671)
Length:
3561
CDS:
396..1409

Additional Resources:

NCBI RefSeq record:
XM_017003739.2
NBCI Gene record:
TMEFF2 (23671)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373777 AGAGCGTCCACGAGGTTAATC pLKO_005 1527 3UTR 100% 13.200 18.480 N TMEFF2 n/a
2 TRCN0000222559 CGTCTGTCAGTTCAAGTGCAA pLKO.1 662 CDS 100% 2.640 2.112 N TMEFF2 n/a
3 TRCN0000373776 ATGCAGAGAATGCTAACAAAT pLKO_005 1108 CDS 100% 13.200 9.240 N TMEFF2 n/a
4 TRCN0000373700 CATACCTTGTCCGGAACATTA pLKO_005 1154 CDS 100% 13.200 9.240 N TMEFF2 n/a
5 TRCN0000073520 GCAGGTGTGATGCTGGTTATA pLKO.1 1234 CDS 100% 13.200 9.240 N TMEFF2 n/a
6 TRCN0000073518 CCTTGCATTTGTGGTAATCTA pLKO.1 1648 3UTR 100% 5.625 3.938 N TMEFF2 n/a
7 TRCN0000073521 GCGCTTCTGATGGGAAATCTT pLKO.1 952 CDS 100% 5.625 3.938 N TMEFF2 n/a
8 TRCN0000073522 CTGGTTATGATGACAGAGAAA pLKO.1 565 CDS 100% 4.950 3.465 N TMEFF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003739.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02827 pDONR223 100% 89.9% 89.3% None (many diffs) n/a
Download CSV