Transcript: Human XM_017003758.2

PREDICTED: Homo sapiens glutamate decarboxylase 1 (GAD1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GAD1 (2571)
Length:
1203
CDS:
391..1065

Additional Resources:

NCBI RefSeq record:
XM_017003758.2
NBCI Gene record:
GAD1 (2571)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003758.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078470 GCTCTCCACTGGATTGGATAT pLKO.1 960 CDS 100% 10.800 6.480 N GAD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003758.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00608 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00608 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470971 GAAAATGGTGAAGAGCAAACAACA pLX_317 66% 100% 100% V5 n/a
4 ccsbBroadEn_06248 pDONR223 100% 37.2% 36% None (many diffs) n/a
5 ccsbBroad304_06248 pLX_304 0% 37.2% 36% V5 (many diffs) n/a
6 TRCN0000479088 GTCCCTGGAGGACGGGATCCCCTT pLX_317 20.2% 37.2% 36% V5 (many diffs) n/a
7 ccsbBroadEn_00609 pDONR223 100% 37.2% 36% None (many diffs) n/a
8 ccsbBroad304_00609 pLX_304 0% 37.2% 36% V5 (many diffs) n/a
9 TRCN0000467890 CACATGTACAGATACATGGTTATT pLX_317 25.4% 37.2% 36% V5 (many diffs) n/a
Download CSV