Transcript: Human XM_017003798.1

PREDICTED: Homo sapiens protein tyrosine phosphatase non-receptor type 18 (PTPN18), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPN18 (26469)
Length:
1959
CDS:
354..1235

Additional Resources:

NCBI RefSeq record:
XM_017003798.1
NBCI Gene record:
PTPN18 (26469)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381010 GTCCTGTGCACCGTGGATTAT pLKO_005 552 CDS 100% 13.200 10.560 N PTPN18 n/a
2 TRCN0000380807 AGGACCCTCAAGGTCACATTC pLKO_005 360 CDS 100% 10.800 7.560 N PTPN18 n/a
3 TRCN0000382258 CTCTTTGATGTGGTCCTTAAG pLKO_005 618 CDS 100% 10.800 7.560 N PTPN18 n/a
4 TRCN0000380069 TAAAGGAGAAGTGGCTGAATG pLKO_005 325 5UTR 100% 10.800 7.560 N PTPN18 n/a
5 TRCN0000003046 ACCAGAACATCAAAGAGAATT pLKO.1 748 CDS 100% 0.000 0.000 N PTPN18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11826 pDONR223 100% 80.3% 80.3% None 0_1ins192;600_605delGACGGG;868_879del n/a
2 ccsbBroad304_11826 pLX_304 0% 80.3% 80.3% V5 0_1ins192;600_605delGACGGG;868_879del n/a
3 TRCN0000472726 CCCACCGGGGCCGAACTTAGATCC pLX_317 21.1% 80.3% 80.3% V5 0_1ins192;600_605delGACGGG;868_879del n/a
4 TRCN0000491725 TCATACATTCGTGTCTCGCGCAGC pLX_317 30.4% 80.3% 80.3% V5 (not translated due to prior stop codon) 0_1ins192;600_605delGACGGG;868_879del n/a
Download CSV