Transcript: Human XM_017003955.1

PREDICTED: Homo sapiens acyl-CoA dehydrogenase long chain (ACADL), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACADL (33)
Length:
2920
CDS:
1080..1949

Additional Resources:

NCBI RefSeq record:
XM_017003955.1
NBCI Gene record:
ACADL (33)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221942 AGGATTTATCAAGGGACGAAA pLKO.1 1376 CDS 100% 4.950 6.930 N ACADL n/a
2 TRCN0000435766 ACTGCTTGCATGGCGAAATAT pLKO_005 1746 CDS 100% 15.000 12.000 N ACADL n/a
3 TRCN0000221940 GAAGTGACTTACAGGGAATAA pLKO.1 1189 CDS 100% 13.200 9.240 N ACADL n/a
4 TRCN0000221939 CCAGGAACTATGTTAAACAAA pLKO.1 1585 CDS 100% 5.625 3.938 N ACADL n/a
5 TRCN0000221941 GCCAATCTATGGTGGTACAAA pLKO.1 1880 CDS 100% 5.625 3.938 N ACADL n/a
6 TRCN0000221938 GCCAGAGTTCAGCCAATCTAT pLKO.1 1869 CDS 100% 5.625 3.938 N ACADL n/a
7 TRCN0000420506 TTCATCAGTAATGGGTCATTA pLKO_005 1263 CDS 100% 13.200 7.920 N ACADL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00005 pDONR223 100% 67.2% 67.2% None 0_1ins423 n/a
2 ccsbBroad304_00005 pLX_304 0% 67.2% 67.2% V5 0_1ins423 n/a
3 TRCN0000481269 TGCATTACACTAGCATGACTTAAG pLX_317 36.5% 67.2% 67.2% V5 0_1ins423 n/a
Download CSV