Transcript: Human XM_017004089.1

PREDICTED: Homo sapiens luteinizing hormone/choriogonadotropin receptor (LHCGR), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LHCGR (3973)
Length:
4595
CDS:
1828..3672

Additional Resources:

NCBI RefSeq record:
XM_017004089.1
NBCI Gene record:
LHCGR (3973)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363161 GTCCTGATTTGGCTGATTAAT pLKO_005 2662 CDS 100% 15.000 10.500 N LHCGR n/a
2 TRCN0000363218 TCATTGTTACATGGCATAAAT pLKO_005 3857 3UTR 100% 15.000 10.500 N LHCGR n/a
3 TRCN0000367986 ACATTGAGCCCGGAGCATTTA pLKO_005 2096 CDS 100% 13.200 9.240 N LHCGR n/a
4 TRCN0000363198 ACCAAGGGCCAGTACTATAAC pLKO_005 2836 CDS 100% 13.200 9.240 N LHCGR n/a
5 TRCN0000363193 CCACTCTCTCACAAGTCTATA pLKO_005 3134 CDS 100% 13.200 9.240 N LHCGR n/a
6 TRCN0000011704 CCTCCTCAATTTGTCTGAAAT pLKO.1 2046 CDS 100% 13.200 9.240 N LHCGR n/a
7 TRCN0000011703 GCTGAACTTTATAGAAGGAAA pLKO.1 3514 CDS 100% 4.950 3.465 N LHCGR n/a
8 TRCN0000011705 GCTGCGATTAAGACATGCCAT pLKO.1 3003 CDS 100% 2.640 1.848 N LHCGR n/a
9 TRCN0000011702 CCACAGAAAGTTCTATCTGTT pLKO.1 4260 3UTR 100% 0.495 0.347 N LHCGR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489581 GGCTGGTCTGCCGTAAGAGATTTA pLX_317 16.9% 80.7% 78.6% V5 (many diffs) n/a
2 TRCN0000488193 TACACGCAAGGTTGAGCTTGGCAA pLX_317 16% 80.7% 78.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV