Transcript: Human XM_017004297.1

PREDICTED: Homo sapiens phosphodiesterase 1A (PDE1A), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDE1A (5136)
Length:
4338
CDS:
102..1739

Additional Resources:

NCBI RefSeq record:
XM_017004297.1
NBCI Gene record:
PDE1A (5136)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048752 CGTCGACTTAAAGAAGAATAT pLKO.1 248 CDS 100% 13.200 18.480 N PDE1A n/a
2 TRCN0000114999 GCTGAATTAGGGCTTCCATTT pLKO.1 1287 CDS 100% 10.800 15.120 N Pde1a n/a
3 TRCN0000048749 CCATGAGTGATGGGTCCTATT pLKO.1 1540 CDS 100% 10.800 8.640 N PDE1A n/a
4 TRCN0000412392 GATGCACTAAGACGATCAAAT pLKO_005 1509 CDS 100% 13.200 9.240 N PDE1A n/a
5 TRCN0000428468 TAAATGGTCTTTCGATGTATT pLKO_005 575 CDS 100% 13.200 9.240 N PDE1A n/a
6 TRCN0000048750 GCCTGAAAGGAATACTAAGAT pLKO.1 190 CDS 100% 5.625 3.938 N PDE1A n/a
7 TRCN0000048751 CGACTTATGCAAGAAGAAGAA pLKO.1 993 CDS 100% 4.950 3.465 N PDE1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491875 AGCGCGGCTCCTGCCAGGGAAGCG pLX_317 37% 70.6% 70.6% V5 1_420del;1576_1635delinsG n/a
Download CSV