Transcript: Human XM_017004307.1

PREDICTED: Homo sapiens GULP PTB domain containing engulfment adaptor 1 (GULP1), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GULP1 (51454)
Length:
2072
CDS:
673..1503

Additional Resources:

NCBI RefSeq record:
XM_017004307.1
NBCI Gene record:
GULP1 (51454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230093 TGCATACACCTGAAGCTTTAT pLKO_005 713 CDS 100% 13.200 9.240 N GULP1 n/a
2 TRCN0000230094 TCCTAAAGTGGAGTTGCAAAT pLKO_005 873 CDS 100% 10.800 7.560 N GULP1 n/a
3 TRCN0000029056 CTCCAATATCACACCAGTCTT pLKO.1 1202 CDS 100% 4.950 3.465 N GULP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11988 pDONR223 100% 47.8% 31.3% None (many diffs) n/a
2 ccsbBroad304_11988 pLX_304 0% 47.8% 31.3% V5 (many diffs) n/a
3 TRCN0000480156 CGGCCTGGATCGGAATGTCCCTAA pLX_317 79.8% 47.8% 31.3% V5 (many diffs) n/a
Download CSV