Transcript: Human XM_017004328.1

PREDICTED: Homo sapiens vitrin (VIT), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VIT (5212)
Length:
2836
CDS:
1129..2403

Additional Resources:

NCBI RefSeq record:
XM_017004328.1
NBCI Gene record:
VIT (5212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373936 GAGAGTCAGGAATCAACATTT pLKO_005 1619 CDS 100% 13.200 9.240 N VIT n/a
2 TRCN0000135415 GCCCAACAAGAGGAAGTTAAT pLKO.1 2136 CDS 100% 13.200 9.240 N VIT n/a
3 TRCN0000135658 GTTTGACAACCTCCATCAGTA pLKO.1 2325 CDS 100% 4.950 3.465 N VIT n/a
4 TRCN0000134423 GAGGAAGTTAATGATCCTCAT pLKO.1 2145 CDS 100% 0.405 0.284 N VIT n/a
5 TRCN0000135338 CAGCAAGTGCTGCTTTACTAA pLKO.1 2424 3UTR 100% 5.625 3.375 N VIT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06715 pDONR223 100% 61.9% 59.7% None (many diffs) n/a
2 ccsbBroad304_06715 pLX_304 0% 61.9% 59.7% V5 (many diffs) n/a
3 TRCN0000481324 AAAACTTCAATTTAGTTGCAGACC pLX_317 22.1% 61.9% 59.7% V5 (many diffs) n/a
Download CSV