Transcript: Human XM_017004353.1

PREDICTED: Homo sapiens peptidylprolyl isomerase like 3 (PPIL3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPIL3 (53938)
Length:
1076
CDS:
91..588

Additional Resources:

NCBI RefSeq record:
XM_017004353.1
NBCI Gene record:
PPIL3 (53938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231440 CACATTAAGGACATAACTATT pLKO_005 544 CDS 100% 13.200 18.480 N PPIL3 n/a
2 TRCN0000000188 CCGACCTCTTAATGATGTACA pLKO.1 525 CDS 100% 4.950 6.930 N PPIL3 n/a
3 TRCN0000101284 CCTCTTAATGATGTACACATT pLKO.1 529 CDS 100% 4.950 3.960 N Ppil3 n/a
4 TRCN0000231441 ATGATAGACCTGGACAAATAA pLKO_005 591 3UTR 100% 15.000 10.500 N PPIL3 n/a
5 TRCN0000231438 GTTGTATCTATGGCTAATAAT pLKO_005 358 CDS 100% 15.000 10.500 N PPIL3 n/a
6 TRCN0000231439 ACCGTATTTGGAAAGGTAATA pLKO_005 448 CDS 100% 13.200 9.240 N PPIL3 n/a
7 TRCN0000000186 AGGTGTTGTATCTATGGCTAA pLKO.1 354 CDS 100% 4.050 2.835 N PPIL3 n/a
8 TRCN0000000187 GAGGTGTTGTATCTATGGCTA pLKO.1 353 CDS 100% 2.640 1.848 N PPIL3 n/a
9 TRCN0000000184 CATCATCCTTCTGCTTGTTTA pLKO.1 674 3UTR 100% 13.200 7.920 N PPIL3 n/a
10 TRCN0000000185 TCTCAGTTCTTCATCACCTAT pLKO.1 397 CDS 100% 4.950 2.970 N PPIL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08356 pDONR223 100% 88% 74.8% None (many diffs) n/a
2 ccsbBroad304_08356 pLX_304 0% 88% 74.8% V5 (many diffs) n/a
3 TRCN0000481560 CTCTGCCCATAACTTCCAGGACTA pLX_317 81.1% 88% 74.8% V5 (many diffs) n/a
4 TRCN0000488890 ACGCTGCTCGCCTAACGTAACAAC pLX_317 74.8% 88% 74.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV