Transcript: Human XM_017004419.1

PREDICTED: Homo sapiens fidgetin, microtubule severing factor (FIGN), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FIGN (55137)
Length:
19473
CDS:
10175..12532

Additional Resources:

NCBI RefSeq record:
XM_017004419.1
NBCI Gene record:
FIGN (55137)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244990 AGGATACAACGGATCATATTT pLKO_005 10813 CDS 100% 15.000 21.000 N FIGN n/a
2 TRCN0000244991 AGTCGGATGAGAACCGAATTT pLKO_005 12059 CDS 100% 13.200 18.480 N FIGN n/a
3 TRCN0000244993 CTTTAGAGTCAGGGTAGATTT pLKO_005 12667 3UTR 100% 13.200 18.480 N FIGN n/a
4 TRCN0000098221 CCCGTTACATATCAAGACTTT pLKO.1 12419 CDS 100% 4.950 6.930 N Fign n/a
5 TRCN0000010038 ATTGCCGGTTCTGGACTAGTC pLKO.1 11900 CDS 100% 0.000 0.000 N FIGN n/a
6 TRCN0000244989 GAACTGTGTTCCGGATGTTAT pLKO_005 10615 CDS 100% 13.200 10.560 N FIGN n/a
7 TRCN0000010043 GCCCGACAACAGCATTTCAAA pLKO.1 11305 CDS 100% 5.625 4.500 N FIGN n/a
8 TRCN0000244992 AGGACCAAATCGTAGTAATTT pLKO_005 12114 CDS 100% 15.000 10.500 N FIGN n/a
9 TRCN0000098223 CCTGGGCGAATGATGACATAT pLKO.1 10410 CDS 100% 13.200 9.240 N Fign n/a
10 TRCN0000010042 CTGAGGACCAAATCGTAGTAA pLKO.1 12111 CDS 100% 5.625 3.938 N FIGN n/a
11 TRCN0000010029 ATTATCACCCAAGGACCTCCA pLKO.1 11678 CDS 100% 2.160 1.512 N FIGN n/a
12 TRCN0000010028 TGGACGAGCAACTGAAGAATA pLKO.1 11622 CDS 100% 13.200 7.920 N FIGN n/a
13 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 1739 5UTR 100% 15.000 7.500 Y KAAG1 n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1735 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487786 CATGCCTTCATGGACACGATCTTC pLX_317 3.2% 81.2% 81.2% V5 (not translated due to prior stop codon) 1_438del;2355_2356insTTG n/a
Download CSV