Transcript: Human XM_017004436.2

PREDICTED: Homo sapiens WD repeat domain 33 (WDR33), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR33 (55339)
Length:
1846
CDS:
200..952

Additional Resources:

NCBI RefSeq record:
XM_017004436.2
NBCI Gene record:
WDR33 (55339)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074841 GCACATAAGGAGGCGATTAGA pLKO.1 797 CDS 100% 5.625 7.875 N WDR33 n/a
2 TRCN0000123608 CCACGGATAATAAATTTGCTA pLKO.1 834 CDS 100% 3.000 4.200 N Wdr33 n/a
3 TRCN0000074840 CCACGGAGGATATGTGAAATA pLKO.1 739 CDS 100% 13.200 9.240 N WDR33 n/a
4 TRCN0000074839 CCTGTGGAATGGACTCACTTT pLKO.1 631 CDS 100% 4.950 3.465 N WDR33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03586 pDONR223 100% 71.8% 65.1% None (many diffs) n/a
2 ccsbBroad304_03586 pLX_304 0% 71.8% 65.1% V5 (many diffs) n/a
3 TRCN0000475255 AATACCATTAGAACGTGCGCCAGA pLX_317 49.5% 71.8% 65.1% V5 (many diffs) n/a
Download CSV