Transcript: Human XM_017004614.1

PREDICTED: Homo sapiens BRCA1 associated RING domain 1 (BARD1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BARD1 (580)
Length:
2134
CDS:
92..2119

Additional Resources:

NCBI RefSeq record:
XM_017004614.1
NBCI Gene record:
BARD1 (580)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350414 GTCTGCGGCCTGTCGATTATA pLKO_005 1770 CDS 100% 15.000 21.000 N BARD1 n/a
2 TRCN0000003745 CCACCTTCATGCAAACGTAAA pLKO.1 1283 CDS 100% 10.800 15.120 N BARD1 n/a
3 TRCN0000350415 GCTCGCGTTGTACTAACATTC pLKO_005 240 CDS 100% 10.800 15.120 N BARD1 n/a
4 TRCN0000369045 TGGTTTAGCCCTCGAAGTAAG pLKO_005 626 CDS 100% 10.800 15.120 N BARD1 n/a
5 TRCN0000377308 TGAAAGTATGAAATCGCTATT pLKO_005 1798 CDS 100% 10.800 7.560 N BARD1 n/a
6 TRCN0000003743 CCAGACACTAAGAGCAGGAAT pLKO.1 1055 CDS 100% 4.950 3.465 N BARD1 n/a
7 TRCN0000003744 GTGGATATAGTCAAGCTGTTA pLKO.1 1709 CDS 100% 4.950 3.465 N BARD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15367 pDONR223 0% 78% 77.9% None (many diffs) n/a
2 ccsbBroad304_15367 pLX_304 0% 78% 77.9% V5 (many diffs) n/a
Download CSV