Transcript: Human XM_017004888.2

PREDICTED: Homo sapiens calcium voltage-gated channel auxiliary subunit beta 4 (CACNB4), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CACNB4 (785)
Length:
6400
CDS:
132..779

Additional Resources:

NCBI RefSeq record:
XM_017004888.2
NBCI Gene record:
CACNB4 (785)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262796 TACGATGTTGTACCGTCAATG pLKO_005 694 CDS 100% 10.800 15.120 N CACNB4 n/a
2 TRCN0000044088 CCACTCAGATTGGAGAACATA pLKO.1 537 CDS 100% 5.625 3.938 N CACNB4 n/a
3 TRCN0000044091 CGGAGGGAAATCAAGTGGAAA pLKO.1 593 CDS 100% 4.950 3.465 N CACNB4 n/a
4 TRCN0000044092 GCAATTCGACAGGAGAGAGAA pLKO.1 291 CDS 100% 4.950 3.465 N CACNB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00202 pDONR223 100% 40.5% 33.8% None (many diffs) n/a
2 ccsbBroad304_00202 pLX_304 0% 40.5% 33.8% V5 (many diffs) n/a
3 TRCN0000476597 TATGCGGCAACACTGTTGCCTGAA pLX_317 24.4% 40.5% 33.8% V5 (many diffs) n/a
Download CSV