Transcript: Human XM_017004892.2

PREDICTED: Homo sapiens chromosome 2 open reading frame 49 (C2orf49), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C2orf49 (79074)
Length:
1010
CDS:
110..796

Additional Resources:

NCBI RefSeq record:
XM_017004892.2
NBCI Gene record:
C2orf49 (79074)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005770 CCATGACTTAACGCATAGGAA pLKO.1 619 CDS 100% 3.000 4.200 N C2orf49 n/a
2 TRCN0000005768 CCCTCATCGTATTTGATGGAA pLKO.1 522 CDS 100% 3.000 4.200 N C2orf49 n/a
3 TRCN0000436326 AGAGGGATTTGCCGAAGAATA pLKO_005 408 CDS 100% 13.200 9.240 N C2orf49 n/a
4 TRCN0000435369 GAACTACTCCAGTGAAGTTAA pLKO_005 684 CDS 100% 13.200 9.240 N C2orf49 n/a
5 TRCN0000418813 GACAGTCTTACTGACCTTTAT pLKO_005 362 CDS 100% 13.200 9.240 N C2orf49 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04039 pDONR223 100% 70.3% 70.3% None 1_114del;504_505ins126 n/a
2 ccsbBroad304_04039 pLX_304 0% 70.3% 70.3% V5 1_114del;504_505ins126 n/a
3 TRCN0000492228 GAGGCCCTGTACATACAGATGGTA pLX_317 67.8% 70.3% 70.3% V5 1_114del;504_505ins126 n/a
Download CSV