Transcript: Human XM_017004978.1

PREDICTED: Homo sapiens calmodulin-lysine N-methyltransferase (CAMKMT), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAMKMT (79823)
Length:
3686
CDS:
10..693

Additional Resources:

NCBI RefSeq record:
XM_017004978.1
NBCI Gene record:
CAMKMT (79823)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147167 CCTGAATACAGTATCTCCTTA pLKO.1 583 CDS 100% 4.950 3.465 N CAMKMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15993 pDONR223 0% 58.1% 58.1% None 1_285del n/a
2 ccsbBroad304_15993 pLX_304 0% 58.1% 58.1% V5 1_285del n/a
3 TRCN0000474446 CCTTTAGGCTTATCGCACCGGAAC pLX_317 97.3% 58.1% 58.1% V5 1_285del n/a
4 ccsbBroadEn_08965 pDONR223 100% 30.6% 30.1% None (many diffs) n/a
5 ccsbBroad304_08965 pLX_304 0% 30.6% 30.1% V5 (many diffs) n/a
6 TRCN0000469789 GGCCGAATCTCGTCAGTGTGCGTT pLX_317 41.6% 30.6% 30.1% V5 (many diffs) n/a
Download CSV