Transcript: Human XM_017005024.1

PREDICTED: Homo sapiens armadillo repeat containing 9 (ARMC9), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARMC9 (80210)
Length:
2887
CDS:
113..2521

Additional Resources:

NCBI RefSeq record:
XM_017005024.1
NBCI Gene record:
ARMC9 (80210)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005024.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172302 CCATGAGATACAGCCGTATGT pLKO.1 1558 CDS 100% 4.950 6.930 N ARMC9 n/a
2 TRCN0000172914 GCTGAAATGATCCGCCAGATA pLKO.1 1682 CDS 100% 4.950 6.930 N ARMC9 n/a
3 TRCN0000173098 CTTTCGGATCTTCTTGGCCAT pLKO.1 1532 CDS 100% 2.160 1.728 N ARMC9 n/a
4 TRCN0000429821 AGGATCTTGTCGCTGCATTTG pLKO_005 291 CDS 100% 10.800 7.560 N ARMC9 n/a
5 TRCN0000168259 CAATGACCTCTTGGACTGTTA pLKO.1 1099 CDS 100% 4.950 3.465 N ARMC9 n/a
6 TRCN0000172583 GCAGCTAAATTCCGAAGAGCT pLKO.1 1717 CDS 100% 2.640 1.848 N ARMC9 n/a
7 TRCN0000429160 GACTCCAAATCATTGACAATT pLKO_005 266 CDS 100% 13.200 7.920 N ARMC9 n/a
8 TRCN0000418341 ATATAAGGAGAATGGACAAAG pLKO_005 706 CDS 100% 10.800 6.480 N ARMC9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005024.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12683 pDONR223 100% 56.7% 56.7% None (many diffs) n/a
2 ccsbBroad304_12683 pLX_304 0% 56.7% 56.7% V5 (many diffs) n/a
3 TRCN0000467154 ATCAGTGCCACCCTGGCCTAATTG pLX_317 23.5% 56.7% 56.7% V5 (many diffs) n/a
Download CSV