Transcript: Human XM_017005033.1

PREDICTED: Homo sapiens solute carrier family 19 member 3 (SLC19A3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC19A3 (80704)
Length:
4286
CDS:
405..2099

Additional Resources:

NCBI RefSeq record:
XM_017005033.1
NBCI Gene record:
SLC19A3 (80704)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415585 TTTAGTTTATGGGAGCTATTT pLKO_005 1925 CDS 100% 13.200 18.480 N SLC19A3 n/a
2 TRCN0000422495 GACAGGACCCGTCATCATAAT pLKO_005 2293 3UTR 100% 13.200 10.560 N SLC19A3 n/a
3 TRCN0000043891 CCAGCTATATGCTTCTTATAA pLKO.1 1750 CDS 100% 15.000 10.500 N SLC19A3 n/a
4 TRCN0000068733 CCCAAGATTCTTCCATCTATA pLKO.1 1534 CDS 100% 13.200 9.240 N Slc19a3 n/a
5 TRCN0000043892 CCACTGTGATCCTCTGCTTAT pLKO.1 448 CDS 100% 10.800 7.560 N SLC19A3 n/a
6 TRCN0000043890 GCATGTATATTACCTACTCAA pLKO.1 1978 CDS 100% 4.950 3.465 N SLC19A3 n/a
7 TRCN0000043888 CCATATTTATCTGGACCAGAT pLKO.1 513 CDS 100% 4.050 2.835 N SLC19A3 n/a
8 TRCN0000043889 GCAGAGAAATAAAGAAGTCAT pLKO.1 1219 CDS 100% 4.950 2.970 N SLC19A3 n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3801 3UTR 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3801 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3801 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09038 pDONR223 100% 87.8% 87.9% None 99A>G;149_352del n/a
2 ccsbBroad304_09038 pLX_304 0% 87.8% 87.9% V5 99A>G;149_352del n/a
3 TRCN0000467705 GCACGGTAGAACACAAGTTGGGAC pLX_317 24.6% 87.8% 87.9% V5 99A>G;149_352del n/a
Download CSV