Transcript: Human XM_017005103.1

PREDICTED: Homo sapiens NCK adaptor protein 2 (NCK2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NCK2 (8440)
Length:
2775
CDS:
535..1677

Additional Resources:

NCBI RefSeq record:
XM_017005103.1
NBCI Gene record:
NCK2 (8440)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005103.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425562 ACTTCTCCGTGTCCCTTAAAG pLKO_005 1490 CDS 100% 13.200 18.480 N NCK2 n/a
2 TRCN0000434745 ATACGTTTGCTGATAGCAATA pLKO_005 2151 3UTR 100% 10.800 15.120 N NCK2 n/a
3 TRCN0000122918 CGGGCTATGTACCGTCCAACT pLKO.1 677 CDS 100% 1.350 1.890 N NCK2 n/a
4 TRCN0000122914 GCTTGTTTGAATCTCACAATT pLKO.1 2356 3UTR 100% 13.200 9.240 N NCK2 n/a
5 TRCN0000122916 GCCTTCGTCAAGTTCGCCTAT pLKO.1 880 CDS 100% 4.050 2.835 N NCK2 n/a
6 TRCN0000122915 CGTGGACAATGTCTACTGCAT pLKO.1 1545 CDS 100% 2.640 1.848 N NCK2 n/a
7 TRCN0000122917 CGACCGCATCTACGACCTCAA pLKO.1 852 CDS 100% 1.350 0.945 N NCK2 n/a
8 TRCN0000097168 GTGATTGAGAAGCCGGAGAAT pLKO.1 1204 CDS 100% 4.950 3.465 N Nck2 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2501 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005103.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01928 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01928 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466009 CCAACGCTTTGACCTTTGCAGGAG pLX_317 28.3% 100% 100% V5 n/a
Download CSV